Crispr effector system based diagnostics for virus detection

A detection system, virus technology, applied in genetic engineering, microbial determination/inspection, DNA/RNA fragments, etc., can solve problems such as expensive, low-sensitivity applications, limited availability, etc.

Pending Publication Date: 2020-05-05
THE BROAD INST INC +2
View PDF41 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, qPCR methods are sensitive but expensive and rely on complex instrumentation, which limits the availability of trained operators in laboratory settings
Other approaches, such as novel approaches combining isothermal nucleic acid amplification with portable platforms (Du et al., 2017; Pardee et al., 2016), offer high detection specificity in point-of-care (POC) settings, but are somewhat less sensitive due to low sensitivity. restricted apps

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Crispr effector system based diagnostics for virus detection
  • Crispr effector system based diagnostics for virus detection
  • Crispr effector system based diagnostics for virus detection

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1- 1

[0654] Example 1 - General Protocol

[0655] There are two ways to perform DNA and RNA diagnostic tests for C2c2. This protocol can also be used with protein detection variants after delivery of detection aptamers. The first is a two-step reaction in which amplification and C2c2 detection are done independently. The second is where everything is combined in one reaction and this is called a two-step reaction. It is important to keep in mind that amplification may not be necessary for higher concentration samples, so it is good to have a separate C2c2 protocol that does not have amplification embedded in it.

[0656] Table 10. CRISPR Effectors Only - No Amplification:

[0657] component Volume (μL) Protein (final 44nM) 2 crRNA (final 12nM) 1 Background target (100ng total) 1 target RNA (variable) 1 RNA sensor probe (125nM) 4 MgCl 2 (final 6mM)

[0658] The reaction buffer was: 40 mM Tris-HCl, 60 mM NaCl, pH 7.3

[0659] This ...

Embodiment 2

[0672] Example 2 - Highly sensitive and specific detection of C2C2-mediated DNA and RNA from C. wiederii

[0673] Rapid, inexpensive, and sensitive nucleic acid tests can aid in point-of-care pathogen detection, genotyping, and disease surveillance. The RNA-guided RNA-targeting CRISPR effector Cas13a (previously known as C2c2) exhibits a "side effect" of promiscuous RNase activity upon target recognition. We combined the collateral effects of Cas13a with isothermal amplification to establish a CRISPR-based diagnostic (CRISPR-Dx), providing rapid DNA or RNA detection with attomolar sensitivity and single-base mismatch specificity. We used this Cas13a-based molecular detection platform, called SHERLOCK (Specific High Sensitivity Enzymatic Reporter UnLOCKing), to detect specific strains of Zika and Dengue viruses, differentiate pathogenic bacteria, genotyping human DNA, and identifying DNA mutations in cell-free tumors. In addition, SHERLOCK reagents can be lyophilized for cold...

Embodiment 3-C2c2

[0791] Example 3 - C2c2 prevents infection and reduces replication of lymphocytic choriomeningitis (LCMV)

[0792] like Figure 67 As indicated in and listed in Table 20 below, guide RNAs were designed to bind to various regions of the LCMV genome.

[0793] Table 20

[0794] gRNA annotation gRNA-seq SEQ ID NO L1 ctcacgaagaaagttgtgcaaccaaaca 624 L2 tcttcaatctggttggtaatggatattt 625 L3 gccaatttgttagtgtcctctataaatt 626 L4 tatctcacagaccctatttgattttgcc 627 L5 aaattcttcattaaattcaccatttttg 628 L6 tatagtttaaacataactctctcaattc 629 S1 atccaaaaagcctaggatccccggtgcg 630 S2 agaatgtcaagttgtattggatggttat 631 S3 aaagcagccttgttgtagtcaattagtc 632 S4 tgatctctttcttctttttgtcccttac 633 S5 tctctttcttctttttgtcccttactat 634 S6 caatcaaatgcctaggatccactgtgcg 635

[0795] Lipofectamine 2000 was used to transfect into 293FT cells a plasmid expressing C. wiede (Lw) C2c2 / Cas13a fused to msfGFP with nuclear ex...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Provided herein is a nucleic acid detection system comprising: a CRISPR system comprising an effector protein and one or more guide RNAs designed to bind to corresponding target molecules; an RNA-based masking construct; and optionally, nucleic acid amplification reagents to amplify target RNA molecules in a sample. In another aspect, the embodiments provide a polypeptide detection system comprising: a CRISPR system comprising an effector protein and one or more guide RNAs designed to bind a trigger RNA, an RNA-based masking construct; and one or more detection aptamers comprising a masked RNApolymerase promoter binding site or a masked primer binding site. In some embodiments, the system may be used to detect viruses in samples.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS [0002] This application claims US Provisional Application No. 62 / 471,931, filed March 15, 2017, US Provisional Application No. 62 / 484,857, filed April 12, 2017, US Provisional Application No. 62 / 530,086, filed July 7, 2017, 2017 Priority to U.S. Provisional Application 62 / 568,315, filed Oct. 5, 2017, U.S. Provisional Application U.S. 62 / 588,138, filed Nov. 17, 2017, and U.S. Provisional Application 62 / 596,735, filed Dec. 8, 2017. The entire contents of the above identified applications are hereby incorporated by reference in their entirety. [0003] Statement Regarding Federally Funded Research [0004] This invention was made with government support under Grant Nos. MH100706, MH110049, AI110818 awarded by the National Institutes of Health and Grant No. HDTRA1-14-1-0006 awarded by the Defense Threat Reduction Agency. The government has certain rights in this invention. technical field [0005] The subject matter disclosed her...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12Q1/6804
CPCC12Q1/68C12Q1/70C12N2310/20Y02A50/30C12Q2521/301C12Q1/34C12N9/22C12N15/102C12N15/113C12N15/115C12N2310/16C12Q1/6851
InventorO·阿布达耶J·戈滕贝格E·S·兰德P·萨贝蒂C·A·弗雷杰C·梅尔沃德J·J·柯林斯F·张
OwnerTHE BROAD INST INC