Unlock instant, AI-driven research and patent intelligence for your innovation.

Specific DNA fragment for sex determination of Mastacembelus armatus and application thereof

A specific and fragmented technology, applied in DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc., can solve problems affecting artificial reproduction and breeding, early identification of male fish, and identification of males and females. Achieve the effects of promoting development, less fish damage, and accurate technology

Active Publication Date: 2020-05-15
INST OF AQUATIC LIFE ACAD SINICA +1
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the sexual maturity of the parents of this species is 2-3 years, and there are no obvious secondary sexual characteristics between the male and female individuals before sexual maturity, and the male and female cannot be distinguished morphologically in the early stage of development. There is a certain error in the accuracy of fish early identification, which directly affects the development of artificial breeding and breeding.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific DNA fragment for sex determination of Mastacembelus armatus and application thereof
  • Specific DNA fragment for sex determination of Mastacembelus armatus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Acquisition of specific DNA tag fragments MAMSM1 and MAMSM2 for sex identification of Elephant echinacea:

[0029] Fifteen males and 15 females were identified by dissecting and observing the gonads, the caudal fin was cut off and the whole genome DNA was extracted, the target genome was digested with Bsa XI restriction endonuclease, and a sequencing library was constructed, Illumina 2b-RAD sequencing was carried out on the sequencing platform, and the published electronic restriction sequence of the echinococcoid genome was used as the reference sequence. Through the comparative genomics analysis of the tag sequences of male and female individuals, the sex-specific DNA fragment tag sequence was obtained, and the corresponding primers were designed according to the position of the tag sequence in the genome for genome walking, and finally the male-specific DNA tag sequence MAMSM1 was obtained. (shown in SEQ ID NO.1) and MAMSM2 (shown in SEQ ID NO.2), no homologous seque...

Embodiment 2

[0031] The method of using the male-specific DNA tags MAMSM1 and MAMSM2 of the echinococcoid:

[0032] 1) The primers designed for the male-specific DNA tag sequences SEQ ID NO.1 and SEQ ID NO.2 of Echinococcus grandis are respectively:

[0033] MAMSM1-F: CTACACAGGCAATACTTGGCAAATGAATAC and MAMSM1-R: ATCAGTCATCTGTGCCTGGGATATATG;

[0034] MAMSM2-F: CTAGAGGAATTGAACTCAGGTGTGATAAAC and MAMSM2-R: AGAGATATGGAGATAAAGACTGTTACTGGC.

[0035] 2) Extract the genome:

[0036] Cut the fin rays of the big spiny loach, and use the DNA extraction kit to extract the genomic DNA. The quality of the extracted DNA was tested by agarose gel electrophoresis and ultraviolet spectrophotometer, and sterilized ddH 2 O was diluted to 50ng / μL and stored at -20°C for later use.

[0037] 3) PCR amplification:

[0038] The reaction system is about 50ng of template DNA; 2×Es Taq Master Mix polymerase 12.5μl; ddH 2 O was 9.5 μl; the upstream and downstream primers were diluted to 10 μM and 1 μl was added; ...

Embodiment 3

[0044] Application of male-specific DNA markers MAMSM1 or / and MAMSM2 in sex identification of eelfish populations:

[0045] 1) Then collect 18 male and female individuals of known gender, and collect fin ray tissue samples and store them in absolute ethanol. Use a DNA extraction kit to extract their genomic DNA, dilute to 50ng / μL and store at -20°C for later use .

[0046] 2) Utilize the method for embodiment 2 to carry out PCR amplification to above-mentioned big spiny carp DNA sample;

[0047] 3) The amplification result is as follows:

[0048] figure 1 Schematic diagram of the results of genetic sex identification of the primers (MAMSM1-F and MAMSM1-R) designed for the male-specific DNA fragment MAMSM1 of Echinococcus machinatus; the female individuals (individual numbers 10-18, 37-45) in the figure cannot be amplified Bands, male individuals (individual numbers: 28-36, 46-54) can amplify a 431bp specific band, M means DL2000DNA marker.

[0049] figure 2 Schematic diagr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of fish sex determination in the field of aquaculture, and particularly relates to a specific DNA fragment for sex determination of Mastacembelus armatus and application thereof. According to the invention, on the basis of the 2b-RAD-seq technology, a genome walking technology is utilized, and a male sex specificity marker of the Mastacembelus armatus is developed; the specific DNA fragment is shown as SEQ ID No. 1 or SEQ ID No. 2. Directed at the specific sequence, the sex of the Mastacembelus armatus can be identified by utilizing conventional PCR amplification and common agarose electrophoresis, and accuracy reaches 100% according to verification results. Compared with previous anatomical detection or genital swelling observation, the technology provided by the invention has the advantages of accuracy, easiness, rapidness, little damage to fish bodies and the like, and the specific DNA fragment provides helps for sexual control breeding of the Mastacembelus armatus, protection of wild resources and development of the breeding industry.

Description

technical field [0001] The invention belongs to the field of sex identification of fish in the field of aquaculture, and in particular relates to a specific DNA fragment and application of the sex identification of echinocoach. Background technique [0002] Mastacembelus armatus, commonly known as spicy cone, stone cone, etc., belongs to the genus Mastacembelus armatus in classification, and is mainly distributed in tropical and subtropical streams and rivers (Cakmak and Alp, 2010). It is mainly distributed in Guangdong Province, Guangxi Zhuang Autonomous Region, Yunnan Province, Hainan Province and Fujian Province (Cheng Qingtai and Zheng Baoshan, 1987). It is a very popular food fish (Li and Xu et al., 2016) and has important economic value. Elephant eel is a dioecious fish, and male individuals of the same age are generally nearly twice as heavy as females, so the breeding of all male eel eel is of great significance to the industrial development of eel eel. However, th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6879C12Q1/6888C12N15/11
CPCC12Q1/6879C12Q1/6888
Inventor 王忠卫薛凌展郭新粉樊海平桂建芳
Owner INST OF AQUATIC LIFE ACAD SINICA
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More