Specific DNA fragment for sex determination of Mastacembelus armatus and application thereof
A specific and fragmented technology, applied in DNA/RNA fragments, recombinant DNA technology, microbial measurement/inspection, etc., can solve problems affecting artificial reproduction and breeding, early identification of male fish, and identification of males and females. Achieve the effects of promoting development, less fish damage, and accurate technology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Acquisition of specific DNA tag fragments MAMSM1 and MAMSM2 for sex identification of Elephant echinacea:
[0029] Fifteen males and 15 females were identified by dissecting and observing the gonads, the caudal fin was cut off and the whole genome DNA was extracted, the target genome was digested with Bsa XI restriction endonuclease, and a sequencing library was constructed, Illumina 2b-RAD sequencing was carried out on the sequencing platform, and the published electronic restriction sequence of the echinococcoid genome was used as the reference sequence. Through the comparative genomics analysis of the tag sequences of male and female individuals, the sex-specific DNA fragment tag sequence was obtained, and the corresponding primers were designed according to the position of the tag sequence in the genome for genome walking, and finally the male-specific DNA tag sequence MAMSM1 was obtained. (shown in SEQ ID NO.1) and MAMSM2 (shown in SEQ ID NO.2), no homologous seque...
Embodiment 2
[0031] The method of using the male-specific DNA tags MAMSM1 and MAMSM2 of the echinococcoid:
[0032] 1) The primers designed for the male-specific DNA tag sequences SEQ ID NO.1 and SEQ ID NO.2 of Echinococcus grandis are respectively:
[0033] MAMSM1-F: CTACACAGGCAATACTTGGCAAATGAATAC and MAMSM1-R: ATCAGTCATCTGTGCCTGGGATATATG;
[0034] MAMSM2-F: CTAGAGGAATTGAACTCAGGTGTGATAAAC and MAMSM2-R: AGAGATATGGAGATAAAGACTGTTACTGGC.
[0035] 2) Extract the genome:
[0036] Cut the fin rays of the big spiny loach, and use the DNA extraction kit to extract the genomic DNA. The quality of the extracted DNA was tested by agarose gel electrophoresis and ultraviolet spectrophotometer, and sterilized ddH 2 O was diluted to 50ng / μL and stored at -20°C for later use.
[0037] 3) PCR amplification:
[0038] The reaction system is about 50ng of template DNA; 2×Es Taq Master Mix polymerase 12.5μl; ddH 2 O was 9.5 μl; the upstream and downstream primers were diluted to 10 μM and 1 μl was added; ...
Embodiment 3
[0044] Application of male-specific DNA markers MAMSM1 or / and MAMSM2 in sex identification of eelfish populations:
[0045] 1) Then collect 18 male and female individuals of known gender, and collect fin ray tissue samples and store them in absolute ethanol. Use a DNA extraction kit to extract their genomic DNA, dilute to 50ng / μL and store at -20°C for later use .
[0046] 2) Utilize the method for embodiment 2 to carry out PCR amplification to above-mentioned big spiny carp DNA sample;
[0047] 3) The amplification result is as follows:
[0048] figure 1 Schematic diagram of the results of genetic sex identification of the primers (MAMSM1-F and MAMSM1-R) designed for the male-specific DNA fragment MAMSM1 of Echinococcus machinatus; the female individuals (individual numbers 10-18, 37-45) in the figure cannot be amplified Bands, male individuals (individual numbers: 28-36, 46-54) can amplify a 431bp specific band, M means DL2000DNA marker.
[0049] figure 2 Schematic diagr...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com