Construction method of heparin C5 isomerase high-catalytic-activity strain

An isomerase and heparin technology is applied in the field of construction of strains with high catalytic activity of heparin C5 isomerase, and can solve the problems of unfavorable industrial production, low catalytic activity, low expression and the like

Active Publication Date: 2020-06-19
JIANGNAN UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Heparin C5 isomerase catalyzes the inversion of glucuronic acid 5-COOH to form iduronic acid. However, the expression level of heparin C5 isomerase is low and the catalytic activity is low, which is not conducive to industrial production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of heparin C5 isomerase high-catalytic-activity strain
  • Construction method of heparin C5 isomerase high-catalytic-activity strain
  • Construction method of heparin C5 isomerase high-catalytic-activity strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Embodiment 1: Preparation of C5, 2-OST and AST IV

[0054] 1. Construction of recombinant Escherichia coli expressing AST IV, 2-OST or C5

[0055] The gene encoding AST IV was connected to the pCold III vector to obtain the recombinant plasmid pCold III-AST IV; the recombinant plasmid pCold III-AST IV was transformed into E. coli BL21 (DE3), and the recombinant E. coli E. coli expressing AST IV was obtained. coliBL21(DE3)-pCold III-AST IV.

[0056] The gene encoding 2-OST was connected with the pET28a vector to obtain the recombinant plasmid pET28a-2OST; the recombinant plasmid pET28a-2OST was transformed into E.coli BL21(DE3) to obtain recombinant E. coli BL21 expressing 2-OST ( DE3)-pET28a-2OST.

[0057] Ligate the gene encoding C5 with the pCold III vector to obtain the recombinant plasmid pCold III-C5; transform the recombinant plasmid pColdIII-C5 into E.coli BL21(DE3) to obtain the recombinant E.coli BL21(DE3) expressing C5 -pColdIII-C5.

[0058] 2. Induced exp...

Embodiment 2

[0065] Example 2: The N-terminus of C5 is fused with the solubilizing tag SET2 of Saccharomyces cerevisiae

[0066] The N-terminus of C5 was fused with MBP, SET2 or SUMO, and the fused genes were respectively connected to the pCold III vector to obtain recombinant plasmids pCold III-MBP-C5, pCold III-SET2-C5, and pCold III-SUMO-C5 (see figure 2 ); Transform the recombinant plasmids pCold III-MBP-C5, pCold III-SET2-C5, pCold III-SUMO-C5 into E. coli respectively to obtain recombinant E. coli BL21 expressing C5 and MBP, SET2 or SUMO fusion (DE3)-pColdIII-MBP-C5, E.coli BL21(DE3)-pColdIII-SET2-C5 or E.coli BL21(DE3)-pColdIII-SUMO-C5.

[0067] The induced expression and purification process were the same as in Example 1.

[0068] The result is as image 3 As shown, the measured enzymatic activity after the N-terminal of C5 was fused with MBP, SET2, and SUMO was 1.91U / mL, 2.41U / mL, and 2.41U / mL, respectively.

Embodiment 3

[0069] Example 3: Molecular modification of C5

[0070] According to the reported enzyme structure analysis, through Discovery Studio molecular docking, the amino acid sites VAL06ASP498, GLY352, and LYS350 within 5 angstroms of the substrate binding pocket were selected, and based on pCold III-SET2-C5, site-directed saturation mutation was performed (mutation primer See Table 1).

[0071] Table 1 Mutation Primers

[0072] Primer name Primer VAL106-F TTGAGGGTTACAACGTGGAANNNCGTGACCGTGTGAAGTGCAT VAL106-R TTCCACGTTGTAACCCTCAAAGCT LYS350-F GATCATGGTGACCCGTNNNCTGGGTGAAGGTTTTCGTGCG LYS350-R ACGGGTCACCATGATCGGC GLY352-F TCATGGTGACCCGTAAACTGNNNGAAGGTTTTCGTGCGCTGGAG GLY352-R CAGTTTACGGGTCACCATGATCGG ASP498-F AACCTGGCGCGTTGGNNNTATCACACCCACCCACATCAACC ASP498-R CCAACGCGCCAGGTTC

[0073] The result is as Figure 4 As shown, using Escherichia coli to express C5-V106R after the 106th amino acid was mutated from valine t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of a heparin C5 isomerase high-catalytic-activity strain, and belongs to the technical field of bioengineering. The method comprises the following steps:firstly, selecting Escherichia coli as host bacteria, then carrying out expression optimization on C5 isomerase by utilizing a way of fusing a solubilizing label at an N end, and further carrying outprotein engineering modification on an optimized C5 protein sequence through molecular docking so as to obtain a high-activity production strain. According to the invention, microbial cells are used for expressing the C5 obtained after mutation of 106 amino acids from valine to arginine for the first time, the catalytic activity of the obtained enzyme is 5.81 U / mL and is improved by 141% comparedwith that before mutation, and the specific enzyme activity is 145.14 U / mg and is improved by 128% compared with that before mutation.

Description

technical field [0001] The invention relates to a method for constructing a strain with high catalytic activity of heparin C5 isomerase, belonging to the technical field of bioengineering. Background technique [0002] Heparin and heparin sulfate are formed by alternating links of glucuronic acid and N-acetylglucosamine. A straight chain negatively charged polysaccharide. Heparin exists on the surface of animal cells or in the extracellular matrix, and is mainly used clinically for the treatment of thromboembolic diseases, myocardial infarction, cardiovascular surgery and postoperative anticoagulation. [0003] At present, the production methods of heparin include biological extraction, chemical enzymatic synthesis, and total enzymatic synthesis. The biological extraction method is mainly extracted from the small intestinal mucosa of animals, but animal tissues also contain a series of other glycosaminoglycans such as chondroitin sulfate, dermatan sulfate, keratan sulfate,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/90C12N15/61C12N15/70C12N1/21C12R1/19
CPCC12N9/90C12N15/70
Inventor康振陈坚王兵兵周正雄金学荣胥睿睿
OwnerJIANGNAN UNIV