Flanking sequence of high-nitrogen-utilization transgenic soybean 8c-ox-2 exogenous insertion element, acquisition method and application
A technology of 8c-ox-2 and transgenic soybeans, applied in biochemical equipment and methods, DNA/RNA fragments, microbial determination/inspection, etc., can solve the problems of unreported 8c-ox-2 flanking sequences of transgenic soybeans, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] The way to obtain transgenic soybean 8c-ox-2: use the cDNA of GmATG8c gene as template, connect it into pMD18-T by TA cloning, recover the GmATG8c fragment after double digestion with Nco I and BstE II, and connect it to The vector pCAMBIA3301 cut with BstEII double enzymes completed the construction of the final vector pCAMBIA-GmATG8c. In the final vector constructed, the CaMV 35S promoter was used to drive the expression of the GmATG8c gene; the screening marker gene was bar.
[0048] Using soybean cDNA as a template, the 360bp GmATG8c gene was amplified by PCR method, and the amplified product was recovered and cloned by TA.
[0049] (1) PCR amplification of the target fragment
[0050] Specific primers were designed according to the sequence of the known soybean autophagy-related gene GmATG8c, an Nco I restriction site was introduced into the upstream primer, and a BstEII restriction site was introduced into the downstream primer.
[0051] Upstream primer (SEQ ID ...
Embodiment 2
[0096] The T-DNA of the transgenic soybean material 8c-ox-2 in Example 1 was found to be inserted between 2779776-2781294 of chromosome 15 through genome resequencing technology, and the insertion method was a forward single-copy insertion (the experiment was provided by Shenzhen Huada Gene Co., Ltd. company completed). Primers were designed according to the upstream and downstream sequences of the insertion interval and T-DNA (see Table 5).
[0097] Table 5 table transgenic soybean 8c-ox-2 transformant detection PCR primers and product information
[0098]
[0099] Part of the T-DNA sequence and the full-length fragments of the left and right flanking sequences were obtained by PCR amplification. PCR reaction system (25μl): DNA template 100ng, 10×buffer 2.5μl, 2.5mM dNTPs 2μl, 10μM primers 1μl each, 5U / μl Taq Enzyme 0.2μl, add ddH 2 O to make up to 25 μl. The PCR reaction program was: 94°C for 5 minutes; 35 cycles of 94°C for 30s, 58°C for 30s, and 72°C for 30s; 72°C fo...
Embodiment 3
[0101] Application of the flanking sequence in Example 2 in the detection of transgenic soybeans.
[0102] Two pairs of primers were designed using the flanking sequences of nitrogen-efficient transgenic soybean (shown in SEQ ID NO.1 and SEQ ID NO.2) and the T-DNA insertion sequence of the exogenous fragment, and the 8c-ox-2 event and its derivatives were established. Qualitative PCR identification method. Design primers SEQ ID NO.3: 5'-AGAGCTTGAAGTGGGTTTAACGTG-3' according to the soybean genome at the 5' end of the integration site in the exogenous fragment, design primers according to the LB region of the vector T-DNA as SEQ ID NO.4: TCCATAATAATGTGTGAGTAGTTCCCAG; Primer designed for the soybean genome at the 3' end of the integration site in the source fragment is SEQID NO.5: 5'-TATGGCTTTCTTTACATGACTTACAGTG-3', and the primer designed according to the RB region of the vector T-DNA is SEQID NO.6: TCTTCTAGGACCACATTATTTTCATTTC. The extraction method of soybean genomic DNA, the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More