A kind of dna molecule and its application and method for obtaining high root mass ramie plants

A DNA molecule, ramie technology, applied in the field of genetic modification, can solve problems such as inconsistent research conclusions

Active Publication Date: 2021-09-17
INST OF BAST FIBER CROPS CHINESE ACADEMY OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

A large number of studies have shown that alternating wet and dry, flooding treatment and drought treatment have significant effects on plant life metabolism, but there are great differences among different crops, different studies and different regions, and the research conclusions are inconsistent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of dna molecule and its application and method for obtaining high root mass ramie plants
  • A kind of dna molecule and its application and method for obtaining high root mass ramie plants
  • A kind of dna molecule and its application and method for obtaining high root mass ramie plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] (1) Acquisition of recombinant Agrobacterium strains containing pBI21-BnWOX8 overexpression vector

[0040] Specific steps are as follows:

[0041] 1). Synthesis of SEQ ID NO.1 sequence:

[0042] It was synthesized by solid-phase phosphoramidite triester method. The sequence of SEQ ID NO.1 is as follows:

[0043] ATTTTATGAATGATCTGTTGATATGTTTTAGACATGTTGATAAGTGGTGCGTTTTTTTCGTTCGATGTGCGTTGTCTTTTTGAGAAACTGCCAAGTTGGGAATTTGATGGCGTAGATATCTGAGACTTTTGTTGCCTGATGTGCTCGTTTCCATGCTTTTGTTGTTTGGGTAATACTTTTGGCATGTTGATATTTGATTGGCTATTGATTTACTAAACAATGTTTTTATTGGGTTTTATTTTGAAAAATTATCCCCAAAGTTTCAAGTTAATGTCAAATGAACATTTTTTATTGACTTTTCTAGACGAGGTGAGGGGTCAGTATAACTTGCGAGTTAGATACAAGATACAAGGGTTTTCTTGATATTGTTTATCCTTTTGGGGCCTAATTTTACGGTTTAGGCCGTATATAATATTTCAAAATTGTCCTTAAAAGCTAAAATAAATTAAATTTTCAATGTTTCTGTGTCTTTATTTTCATTGGTCATTGTTAAGCGAAGATGATTTGGAGATCAGCCGCGAACGTATCGTATCGGTTCGGTTACTAAAAACACCCCTCTTCGTCGGCTTATGGTCTTTGTGTCTCAATTGTCTCTGTCTCAATGTCTCATGTCTCATGTCTCATGTCTCATGTCTCATGTCTCAGTCACTTGTCTCATGTCTCATATT...

Embodiment 2

[0067] In Example 2, the ramie plants obtained by the genetic transformation method using callus as explants were hydrocultured with the ramie variety before modification, and the ramie variety before modification was Zhongzhu No. 2. At the same time, unmodified Zhongzhu No. 2 was selected for water cultivation. Root biomass was measured after 45 days of cultivation.

[0068] The hydroponics method is as follows:

[0069] The ramie plants obtained in the present invention and the common No. 2 ramie plants are topped to remove the top dominance and promote the growth of side branches. When the lateral branch reaches 12cm, it is collected uniformly, trimmed, and cultivated by the disclosed method of ramie water cultivation seedling using the patented ramie factory seedling raising method (CN105052528B). Root biomass was measured after 45 days of cultivation.

[0070] Table 2 Determination of ramie root biomass (dry weight)

[0071]

[0072] Note: * indicates that there is...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of transgenics, in particular to a DNA molecule, its application and a method for obtaining ramie plants with high root mass. In the DNA molecule, the 2000-2500 bp sequence upstream of the translation start site of the 5' end untranslated region of the ramie BnWOX8 gene is replaced by the sequence of SEQ ID NO: 1. The invention transfers the modified DNA molecule into the ramie plant, and the obtained ramie line shows higher production capacity of the root system, and has no significant influence on the total flavonoid content in the root system.

Description

technical field [0001] The invention relates to the technical field of transgenics, in particular to a DNA molecule, its application and a method for obtaining ramie plants with high root mass. Background technique [0002] Ramie is a traditional economic crop in my country. It has been used as a medicinal material for a long time, especially in ethnic medicine. The part of ramie commonly used in Chinese medicinal materials is the root system. Zang Consolidation et al. (2002) mentioned in "Analysis of Ramie Medicinal Valuation Value and Its Development Prospect" that ramie is mainly used in internal medicine for gynecology, urology, respiratory system, digestive system, diabetes and other diseases. The ramie root contains flavonoid glycosides, ursolic acid, superoxide dismutase (SOD) and other substances, wherein every 100g ramie root dry powder contains 0.36g of flavonoids and 0.37g of phenols. Chen Baofeng et al. (2016) counted 11 types of flavonoids in the root system o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/84C12N1/21A01H4/00A01H5/06A01H6/84
CPCA01H4/001A01H4/008C07K14/415C12N15/8227C12N15/8243
Inventor 高钢朱爱国喻春明陈平陈坤梅王晓飞陈继康
Owner INST OF BAST FIBER CROPS CHINESE ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap