A kind of dna molecule and its application and method for obtaining high root mass ramie plants
A DNA molecule, ramie technology, applied in the field of genetic modification, can solve problems such as inconsistent research conclusions
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] (1) Acquisition of recombinant Agrobacterium strains containing pBI21-BnWOX8 overexpression vector
[0040] Specific steps are as follows:
[0041] 1). Synthesis of SEQ ID NO.1 sequence:
[0042] It was synthesized by solid-phase phosphoramidite triester method. The sequence of SEQ ID NO.1 is as follows:
[0043] ATTTTATGAATGATCTGTTGATATGTTTTAGACATGTTGATAAGTGGTGCGTTTTTTTCGTTCGATGTGCGTTGTCTTTTTGAGAAACTGCCAAGTTGGGAATTTGATGGCGTAGATATCTGAGACTTTTGTTGCCTGATGTGCTCGTTTCCATGCTTTTGTTGTTTGGGTAATACTTTTGGCATGTTGATATTTGATTGGCTATTGATTTACTAAACAATGTTTTTATTGGGTTTTATTTTGAAAAATTATCCCCAAAGTTTCAAGTTAATGTCAAATGAACATTTTTTATTGACTTTTCTAGACGAGGTGAGGGGTCAGTATAACTTGCGAGTTAGATACAAGATACAAGGGTTTTCTTGATATTGTTTATCCTTTTGGGGCCTAATTTTACGGTTTAGGCCGTATATAATATTTCAAAATTGTCCTTAAAAGCTAAAATAAATTAAATTTTCAATGTTTCTGTGTCTTTATTTTCATTGGTCATTGTTAAGCGAAGATGATTTGGAGATCAGCCGCGAACGTATCGTATCGGTTCGGTTACTAAAAACACCCCTCTTCGTCGGCTTATGGTCTTTGTGTCTCAATTGTCTCTGTCTCAATGTCTCATGTCTCATGTCTCATGTCTCATGTCTCATGTCTCAGTCACTTGTCTCATGTCTCATATT...
Embodiment 2
[0067] In Example 2, the ramie plants obtained by the genetic transformation method using callus as explants were hydrocultured with the ramie variety before modification, and the ramie variety before modification was Zhongzhu No. 2. At the same time, unmodified Zhongzhu No. 2 was selected for water cultivation. Root biomass was measured after 45 days of cultivation.
[0068] The hydroponics method is as follows:
[0069] The ramie plants obtained in the present invention and the common No. 2 ramie plants are topped to remove the top dominance and promote the growth of side branches. When the lateral branch reaches 12cm, it is collected uniformly, trimmed, and cultivated by the disclosed method of ramie water cultivation seedling using the patented ramie factory seedling raising method (CN105052528B). Root biomass was measured after 45 days of cultivation.
[0070] Table 2 Determination of ramie root biomass (dry weight)
[0071]
[0072] Note: * indicates that there is...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com