Application of cotton GHPSAT2 gene in promoting flowering of plants

A gene and plant technology, applied in the application field of GHPSAT2 gene in promoting plant flowering, can solve problems such as few researches

Active Publication Date: 2020-09-01
INST OF COTTON RES CHINESE ACAD OF AGRI SCI +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The PSAT2 gene belongs to the aspartate aminotransferase family and is currently poorly studied in plants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of cotton GHPSAT2 gene in promoting flowering of plants
  • Application of cotton GHPSAT2 gene in promoting flowering of plants
  • Application of cotton GHPSAT2 gene in promoting flowering of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0023] The following examples are used herein to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to be employed in the practice of the invention, and thus can be considered preferred modes for its practice. However, those skilled in the art should understand from this specification that many modifications can be made to the specific embodiments disclosed herein, and the same or similar results can still be obtained without departing from the spirit or scope of the present invention.

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this invention belongs, and the disclosures cited herein and their cited materials are all incorporated by reference .

[0025] Those skilled in the art will recognize, or ...

Embodiment PBI121

[0035] The construction of embodiment PBI121-GhPSAT2 expression vector

[0036] 1 Obtain the gene sequence of GhPSAT2 (Gh_D07G1721) from CottonFGD, use Oligo 7 software to design primers, and use PCR method to amplify from upland cotton No. The molecular weight is 46.26213kDa, and the isoelectric point is 8.52.

[0037] Amplification primers are as follows:

[0038] Upstream primer F (SEQ ID No.1): 5'-ATGGCAGCAACATCTCTAAAT-3'

[0039] Downstream primer R (SEQ ID No.2): 5'-TCAAGCATGCTTTGCCTGGAA-3'

[0040] The open reading frame sequence is (SEQ ID No.3):

[0041]ATGGCAGCAACATCTCTAAATGCCCCTAACGCTCCTCTCCTTCAAAA GACCCATCAAACTCATGTCTTTCTCAAACCCATCTCCACCATTCCTTGTCA AACCTCTGCCAAGCGCTTCTCCATCTCTTGTTCCGCAACTACCCAAGATCG CCTCTCCGTCCAATCCCAATCTCAAGATCGGGTCTTTAACTTCGCCGCCGG TCCCGCCACCTTACCCGAGAACGTCCTCCTCAAAGCCCAATCCGAGCTTT ACAACTGGCACGGATCTGGCATGAGCGTTATGGAAATGAGCCACCGTGGT AAGGATTTCCGTTCTATTATCGAAAAAGCCGAGGCCGATCTCCGTTCTCTT CTCAACATCCCTGAAAACTACGCCGTTTTGTTCCTCCAAGGTGGAGCCAC CACCCAGTTC...

Embodiment 2

[0145] Transformation of Arabidopsis thaliana mediated by embodiment 2 Agrobacterium

[0146] Transformation of Arabidopsis thaliana by inflorescence dipping method

[0147] 1) Inoculate 20 μL of the Agrobacterium liquid cultured at -20°C into 1 mL of LB liquid medium, shake at 28°C and 180 rpm overnight, and take 200 μL of the activated bacteria liquid and add it to 50 mL of LB liquid medium at 28°C and shake at 180 rpm.

[0148] 2) OD of the bacteria solution 600 When the value is about 1.2, centrifuge at 5,000rpm for 5min to collect the bacteria.

[0149] 3) Discard the supernatant, and use 50-70ml transformation medium to reselect the bacterial solution to make the OD 600 Infection begins after the value is 0.8-1.0 (transformation medium formula: 0.217g 1 / 2MS, 5g sucrose, 100mL water dissolved, then add 20μL silwetL-77).

[0150]4) Select unflowered Arabidopsis thaliana, place the Arabidopsis inflorescences in the transformation medium for 30-50 seconds, place them hori...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention discloses application of a cotton GHPSAT2 gene in promoting flowering of plants, and belongs to the technical field of plant genetic engineering. The GHPSAT2 gene has a nucleotide sequence as shown in SEQ ID No. 3 and can encode an amino acid sequence as shown in SEQ ID No. 4. According to the GHPSAT2 transgenic arabidopsis thaliana plant obtained through the transgenic technology, the flowering time of arabidopsis thaliana is remarkably advanced, and it is shown that the GHPSAT2 gene has a key effect on promoting cotton flowering. According to the invention, a favorable gene resource is provided for short-season cotton cultivation.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to the application of GHPSAT2 gene in promoting flowering of plants. Background technique [0002] Cotton is an important economic crop and textile raw material in China, and plays an irreplaceable role in the development of China's national economy. However, my country has a large population and a relatively small area of ​​arable land, and the contradiction between grain and cotton competing for land is prominent. Early-maturing cotton is a cotton type that is suitable for alleviating the current situation of land competition for grain and cotton and the gradual reduction of vegetation area. Taking advantage of its short growth period and late sowing characteristics, it can achieve double cropping of grain and cotton in one year with winter crops, improve the multiple cropping index of land, expand cotton planting areas, avoid seedling pests and dise...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/10C12N15/82A01H5/00A01H6/20
CPCC12N9/1096C12N15/827C12Y206/01001
Inventor 喻树迅程小倩魏恒玲李林王寒涛马亮付小康
Owner INST OF COTTON RES CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap