Unlock instant, AI-driven research and patent intelligence for your innovation.

Strawberry transcription factor for promoting precocious flowering of plants and application thereof

A technology for early flowering and transcription factors, applied in the fields of molecular biology and genetic engineering

Active Publication Date: 2017-08-18
SHENYANG AGRI UNIV
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there are few reports on their involvement in the regulation of plant flowering

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Strawberry transcription factor for promoting precocious flowering of plants and application thereof
  • Strawberry transcription factor for promoting precocious flowering of plants and application thereof
  • Strawberry transcription factor for promoting precocious flowering of plants and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Cloning of Strawberry WRKY46 Gene

[0025] (1) The diploid forest strawberry 'Ruegen' was used as the test material, and the material was grown in a greenhouse.

[0026] (2) RNA extraction: the total RNA of the test material was extracted by the CTAB method, and the whole operation process followed the RNA extraction process of the CTAB method, and then the total RNA was used as a template to reverse transcribe to obtain the first strand of cDNA.

[0027] (3) Cloning of the gene: using the first strand of reverse-transcribed fruit cDNA as a template, PCR amplification was performed using primers WRKY46-F and WRKY46-R, and the PCR product was recovered to obtain a target fragment of 1107 bp.

[0028] WRKY46-F: GCAGGTACCATGTCAAATGAAAAGAAAAGCCC

[0029] WRKY46-R: GCAGAATTCTGGCTCCTCCAGCTTGTGAC

[0030] Note: The first nine bases in the WRKY46-F and WRKY46-R primer sequences, namely GCAGGTACC and GCAGAATTC, are required for the construction of vectors, artificially added r...

Embodiment 2

[0032] Construction of plant expression vectors

[0033] (1) After the target fragment was recovered from the gel, it was connected to the pMD18-T vector (purchased from TaKaRa Company), and then transformed into Escherichia coli competent cells Trans5α (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), and positive single colonies were screened, Plasmids were extracted and sequenced.

[0034] (2) EcoRI and KpnⅠ were used to double-enzyme digest the correctly sequenced WRKY46-pMD18-T recombinant plasmid and pRI101-GFP plasmid respectively, recover the large vector fragment and the target gene fragment, and transform Escherichia coli Trans5α competent cells after ligation with T4 ligase (purchased from Beijing Quanshijin Biotechnology Co., Ltd.), after identifying the recombinant, a plant expression vector with the gene of interest was obtained.

Embodiment 3

[0036] Transformation of Arabidopsis for functional verification

[0037] (1) Infect Arabidopsis thaliana by flower dipping method.

[0038] Pick a positive clone of Agrobacterium GV3101 containing the target gene WRKY46, inoculate it in the liquid YEP medium of LB+Kan (kanamycin) 50mg / L+Rif (rifampicin) 25mg / L, and culture with shaking at 28°C 200rpm At 24 hours, take 1ml of the cultured bacteria liquid and add 50ml of liquid YEP medium to activate, so that OD 600 = about 0.8.

[0039] Transfer the bacterial solution into a sterile 50ml centrifuge tube, centrifuge at 5000rpm for 10min to collect the bacterial species, and then resuspend the bacteria with the same volume of MS resuspension (1 / 2MS+0.5g / L MES+5%Sucrose, pH5.7) Agrobacterium was suspended, and the surfactant Silwet was added to make the final concentration 0.03% (300 μl / L).

[0040] Soak the inflorescences of Arabidopsis plants that have just bloomed in this solution for 30s. The inflorescence cover membrane o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a strawberry transcription factor for promoting precocious flowering of plants and application thereof, and belongs to the field of genetic engineering in molecular biology. The strawberry transcription factor is characterized in that a full-length coding region sequence of the strawberry WRKY46 gene for promoting precocious flowering of the plants is shown in the sequence table SEQ ID NO:1; an amino acid sequence is shown in the sequence table SEQ ID NO:2. The strawberry FvWRKY46 gene for promoting precocious flowering of the plants is used for constructing plant expression vectors of the FvWRKY46 gene, the constructed plant expression vectors transform arabidopsis thaliana through agrobacteria, genetically modified arabidopsis thaliana plants are obtained and flower early, and it is shown that the FvWRKY46 gene has the function of inducing precocious flowering of arabidopsis thaliana. According to the strawberry transcription factor for promoting precocious flowering of the plants, a genetic engineering technology is adopted, technical means and theoretical bases are provided for regulating the flowering time of strawberries, and the strawberry transcription factor has great application value.

Description

[0001] Technical field: [0002] The invention belongs to the technical fields of molecular biology and genetic engineering, and in particular relates to a strawberry transcription factor for promoting early flowering of plants and an application thereof. [0003] Background technique: [0004] Strawberry is a plant of the genus Fragaria in the family Rosaceae. Strawberry fruit is delicious, red and tender, with juicy pulp, sweet and sour taste, and has a special strong fruit aroma. Strawberry has high nutritional value, good color, aroma and taste. Due to its unique flavor and rich nutrients, it is one of the most widely cultivated berries and has the reputation of "Queen of Fruits". [0005] Flowering is an important process for plants to transform from vegetative growth to reproductive growth. It is an important agronomic trait, which determines whether a plant is suitable for a specific cultivation area and growing season. Plant flowering is the key to the transition of p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/11C12N15/82C12N5/10A01H5/00
CPCC07K14/415C12N15/827
Inventor 张俊祥孙一平张志宏石伟佳王保田
Owner SHENYANG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More