Method for regulating plant salt tolerance and salt tolerance related protein

A salt-tolerance and salt-tolerance technology, applied in the field of regulating plant salt-tolerance and salt-tolerance-related proteins, can solve problems such as lack of understanding

Active Publication Date: 2021-10-08
INST OF BOTANY CHINESE ACAD OF SCI
View PDF12 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, there are relatively few studies on the regulatory network of salt stress in rice crops. Although some germplasm resources of salt tolerance have been initially accumulated, there is still relatively little understanding of the main key genes or main QTLs controlling salt tolerance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for regulating plant salt tolerance and salt tolerance related protein
  • Method for regulating plant salt tolerance and salt tolerance related protein
  • Method for regulating plant salt tolerance and salt tolerance related protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0083] Embodiment 1, the cloning of the rice OsPRR73 coding gene related to salt tolerance

[0084] The inventors of the present invention isolated and cloned a rice gene OsPRR73 related to salt tolerance from rice Nipponbare, as shown in Sequence 1 of the Sequence Listing, and named its encoded protein OsPRR73 protein, as shown in Sequence 2 of the Sequence Listing.

[0085] The rice Nipponbare total RNA was extracted and reverse-transcribed into cDNA, and PCR amplification was performed with primers F:ATGGGTAGCGCCTGCGAAGC and R:TTATCTGTCTTCGTCTTGGC. The PCR reaction program was: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, and 35 cycles; extension at 72°C for 5 min. The PCR products were subjected to Sanger sequencing. Sequencing results show that the nucleotide sequence of the PCR amplification product is sequence 1 in the sequence listing, its coding sequence is the 1st-2304th nucleotide of sequ...

Embodiment 2

[0086] Embodiment 2. OsPRR73 deletion mutant rice construction

[0087] 1. Construction of vectors and recombinant bacteria

[0088]Use the DNA sequence shown in Sequence 1 to screen for suitable targets on the E-CRISPR website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html). Combining the scores and target positions, ATGGGTAGCGCCTGCGAAGCTGG located on the first exon of OsPRR73 was selected as one of the CRISPR / Cas9 targets. Synthetic primer sequences F: ggcATGGGTAGCGCCTGCGAAGC and R: aaacGCTTCGCAGGCGCTACCCA, according to the literature (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R ,Chen S,Wang Z,Chen Y,Guo J,Chen L,Zhao X,Dong Z,Liu Y-G(2015)A Robust CRISPR / Cas9 System for Convenient,High-Efficiency Multiplex Genome Editing in Monocot and DicotPlants.Mol Plant 8: 1274-1284) to construct the pCRISPR / Cas9 vector system to the vector pCRISPR / Cas9-OsPRR73. The vector pCRISPR / Cas9-OsPRR73 was introduced into Agrobacterium EHA105 comp...

Embodiment 3

[0093] Example 3 Identification of transgenic rice CRISPR / Cas9-OsPRR73 T0 generation plants

[0094] DNA was extracted from the leaves of the T0 generation of the rice OsPRR73 mutant, and the extracted DNA was used as a template to perform PCR amplification with OsPRR73-specific primers. The primer sequences were F: ACGTTGGGCGTATGATGCA; R: TCACCATGCTATGAAGCT. The PCR reaction program was: pre-denaturation at 94°C for 2 min; denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s, and 35 cycles; extension at 72°C for 5 min. The PCR product was subjected to Sanger sequencing to check whether the target site was mutated.

[0095] Wherein, the extraction of leaf DNA was carried out as follows: rice leaves were put into a 1.5 mL centrifuge tube, steel balls were added and ground into powder with a grinder. Add 500 μL of extraction buffer to the centrifuge tube and shake to mix. Add an equal volume of chloroform and phenol (1:1) mixture, shake and mix...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for regulating the salt tolerance of plants and salt-tolerance-related proteins. The invention provides a method for cultivating and regulating the salt-tolerance of plants, which includes regulating the expression of genes encoding salt-tolerance-related proteins in target plants, wherein , the salt-tolerance-related protein is a salt-tolerance-related protein from rice, the name is OsPRR73, and it is from rice Nipponbare. The present invention uses CRISPR / Cas9 technology to obtain OsPRR73 function-deficient mutants, performs 180mM NaCl simulated salt stress treatment, observes the phenotype and counts the survival rate after recovery treatment, and finally confirms that OsPRR73 plays a positive role in the process of responding to rice salt stress effect. The OsPRR73 of the present invention can be used as a salt tolerance gene and play an important role in rice salt resistance.

Description

technical field [0001] The invention relates to a salt-tolerant related protein OsPRR73 and its related biological material and a method for cultivating salt-tolerant plants in the field of biotechnology. Background technique [0002] Rice (Oryza sativa L.) is one of the most important food crops in my country. With the development of modern agriculture, rice production has been greatly increased. However, the negative effects brought about by environmental degradation have seriously hindered the development of modern agriculture. Among them, soil salinization is one of the main stresses faced by plants and has become a serious problem threatening the development of global agriculture. It is estimated that about 6% of the global land area is affected by salinization, including nearly 45 million hectares of irrigated land (Munns and Tester, 2008). [0003] Grass crops are extremely sensitive to abiotic stress, especially rice and wheat, where yield declines are most pronoun...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/84C07K14/415C12N15/29C12N5/10A01H5/00A01H6/46
CPCC07K14/415C12N15/8218C12N15/8273
Inventor王雷魏华王希岭
OwnerINST OF BOTANY CHINESE ACAD OF SCI