Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

DNA extraction reagent, and kit and method for detecting transgenosis of corn kernels

A technology of genetically modified corn, applied in the biological field, can solve the problems of long extraction time, affecting the production of enterprises, affecting the overall speed of corn genetically modified components detection, etc., to achieve the effect of optimizing the DNA extraction scheme and shortening the DNA extraction time.

Inactive Publication Date: 2020-09-22
JILIN ACAD OF AGRI SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

During the storage process, logistics vehicles must get the test results within about 3 hours and deliver the corn to the designated site, otherwise the production of the enterprise will be seriously affected
[0003] In addition, in the existing corn genetically modified component detection scheme, in order to ensure the DNA quality, a long time water bath cracking process is generally introduced in the DNA extraction process, resulting in a long DNA extraction time, which will affect the overall speed of corn genetically modified component detection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • DNA extraction reagent, and kit and method for detecting transgenosis of corn kernels
  • DNA extraction reagent, and kit and method for detecting transgenosis of corn kernels

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] This embodiment provides a test kit for detecting corn grain transgenes, which includes standard DNA of corn grains, a pair of internal reference gene primers, a pair of primers for target genes, and DNA for extracting DNA from corn grains with a water content not higher than 45%. Extract reagents. Wherein, the standard DNA of corn kernels refers to reference DNA, or DNA extracted from traceable standard substances, or DNA extracted from known sequence-positive samples (or organisms). The internal reference gene primer pair includes TUB-F and TUB-R, the nucleotide sequences of which are TUB-F: CTACCTCACGGCATCTGCTATGT; TUB-R: GTCACACACACTCGACTTCACG (as shown in the sequence table SEQ ID NO: 1-2), but not limited thereto. The target gene primer pair is designed for the transgenic component in the corn grain, which can be designed according to the actual required detection of the transgenic component without limitation; for example, for the pCaMV35S transgenic component, t...

Embodiment 2

[0043] This example provides a kit for detecting transgenes in corn kernels, which is different from Example 1 in that the DNA extraction reagents used are different.

[0044] Specifically, the DNA extraction reagent includes solution A, solution B, solution C and solution D.

[0045] Among them, the preparation method of solution A is as follows: trishydroxymethylaminomethane 1g, ethylenediaminetetraacetic acid 0.01g, sodium chloride 6.5g, sorbitol 2g, cetyltrimethylammonium bromide 0.8g, ten Mix 2 g of sodium dialkyl sulfate, 600 μL of 10 mol / L hydrochloric acid, 0.5 mL of β-mercaptoethanol, and 0.5 g of polyvinylpyrrolidone, and then dilute to 120 mL with pure water to obtain solution A.

[0046] Solution B was prepared by mixing 470 mL of chloroform and 30 mL of isoamyl alcohol.

[0047] Solution C was prepared by mixing 70 mL absolute ethanol and 30 mL isopropanol.

[0048] Solution D is ribonuclease A solution, which is prepared from ribonuclease A and 1×TE buffer, whe...

Embodiment 3

[0050] This example provides a kit for detecting transgenes in corn kernels, which is different from Example 1 in that the DNA extraction reagents used are different.

[0051] Specifically, the DNA extraction reagent includes solution A, solution B, solution C and solution D.

[0052]Among them, the preparation method of solution A is as follows: 3g of trishydroxymethylaminomethane, 0.05g of ethylenediaminetetraacetic acid, 8.5g of sodium chloride, 4g of sorbitol, 1.5g of cetyltrimethylammonium bromide, Mix 3 g of sodium dialkyl sulfate, 800 μL of 11 mol / L hydrochloric acid, 1.5 mL of β-mercaptoethanol, and 1.5 g of polyvinylpyrrolidone, and then dilute to 120 mL with pure water to obtain solution A.

[0053] Solution B was prepared by mixing 490 mL of chloroform and 10 mL of isoamyl alcohol.

[0054] Solution C was prepared by mixing 90 mL absolute ethanol and 10 mL isopropanol.

[0055] Solution D is ribonuclease A solution, which is prepared from ribonuclease A and 1×TE b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention is applicable to the technical field of biology, and provides a DNA extraction reagent, and a kit and a method for detecting transgenosis of corn kernels. The DNA extraction reagent is used for extracting DNA of the corn kernels, and comprises a solution A, a solution B, a solution C and a solution D; the solution A comprises the following components: trihydroxymethyl aminomethane, ethylenediamine tetraacetic acid, sodium chloride, sorbitol, hexadecyl trimethyl ammonium bromide, lauryl sodium sulfate, hydrochloric acid, beta-mercaptoethanol and polyvinylpyrrolidone; the solutionB comprises trichloromethane and isoamyl alcohol; the solution C comprises absolute ethyl alcohol and isopropanol; and the solution D is ribonuclease solution. By adjusting the formula of the components, the DNA extraction scheme is optimized, and high-temperature water bath cracking is not needed in the extraction process, so that the DNA extraction time can be effectively shortened, and the quality of the extracted DNA is superior to that of the DNA extracted by the traditional scheme.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a DNA extraction reagent, a kit and a method for detecting corn grain transgene. Background technique [0002] When purchasing and storing corn, enterprises need to test whether the corn contains genetically modified ingredients. According to industry standards, it takes 5 to 10 working days to get accurate results when testing in various qualified testing institutions. During the storage process, the logistics vehicles must get the test results within about 3 hours and deliver the corn to the designated site, otherwise the production of the enterprise will be seriously affected. [0003] In addition, in the existing corn genetically modified component detection scheme, in order to ensure the DNA quality, a long time water bath cracking process is generally introduced in the DNA extraction process, resulting in a long DNA extraction time, which will affect the overall sp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10C12Q1/6851C12Q1/6895
CPCC12N15/1003C12Q1/6851C12Q1/6895C12Q2600/166
Inventor 李毅丹郝东云
Owner JILIN ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com