Unlock instant, AI-driven research and patent intelligence for your innovation.

2019-nCoV nucleic acid isothermal amplification detection kit based on SYBR Green I and detection method

A 2019-ncov, constant temperature amplification detection technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, resistance to vector-borne diseases, etc., can solve the problem of high technical requirements for operators and the inability to screen large-scale populations , can not be promoted and used at the grassroots level, and achieve the effects of saving experimental time, fast constant temperature amplification, and short detection time

Pending Publication Date: 2020-10-27
HANGZHOU YORK BIOTECH CO LTD
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the relatively high price of the current PCR instrument, this condition is basically available in the laboratories of tertiary hospitals, and the technical requirements for operators are relatively high, so it cannot be popularized and used at the grassroots level
When a large-scale outbreak occurs, it is impossible to efficiently screen a large number of people

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 2019-nCoV nucleic acid isothermal amplification detection kit based on SYBR Green I and detection method
  • 2019-nCoV nucleic acid isothermal amplification detection kit based on SYBR Green I and detection method
  • 2019-nCoV nucleic acid isothermal amplification detection kit based on SYBR Green I and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0040] Embodiment: A 2019-nCoV nucleic acid constant temperature amplification detection kit based on SYBR Green I described in this embodiment of the present invention includes 2019-nCoV virus primers and SYBR Green I; 2019-nCoV virus primers include ORF1ab gene Primers and N gene primers, the ORF1ab gene primer sequences are shown as ORF1ab-F and ORF1ab-R; the N gene primer sequences are shown as N-F and N-R.

[0041] The primer sequence list is:

[0042] ORF1ab gene:

[0043] AAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTT TACACTTAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCA

[0044] ORF1ab gene primer sequence: ORF1ab-F:

[0045] TAATACGACTCACTATAGGGCCCTGTGGGTTTTACACTTAA

[0046] ORF1ab gene primer sequence: ORF1ab-R:

[0047] TAATACGACTCACTATAGGGACGATTGTGCATCAGCTGA

[0048] N gene:

[0049] GGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGG GAGCCTTGAATACAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a 2019-nCoV nucleic acid isothermal amplification detection kit based on SYBR Green I and a detection method. The kit comprises an ORF1ab gene primer sequence and an N gene primer sequence of a 2019-nCoV virus, an SYBR Green I dye, an NASBA amplification buffer solution and an NASBA enzyme mixed solution. The detection method using the kit comprises the following steps: firstly, preparing the NASBA amplification buffer solution, preparing the NASBA enzyme mixed solution, preparing a primer mixed solution and preparing an RNA sample; and carrying out mixed reaction on all the solutions, carrying out incubating, and finally completing detection by using a fluorescence detector. The kit and the method show high-specificity and high-sensitivity detection performance, and a large amount of experimental time is saved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a detection kit and a detection method for rapid detection of 2019-nCoV virus based on constant temperature amplification technology and SYBR Green I technology. Background technique [0002] At present, the more commonly used laboratory diagnostic techniques can be divided into virus cell culture techniques, imaging examinations, electron microscopy examinations, serological examinations, and molecular biological examinations. Among them, virus cell culture isolation is currently the most accurate method, but lacks the sensitivity and speed required for high-throughput screening, which may lead to delays in disease progression; serological methods such as ELISA have low specificity and cannot be diagnosed. Molecular biology detection method is now most common with qRT-PCR method, which has the advantages of high sensitivity, good specificity, wide linear range and accura...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/701C12Q1/6844C12Q2531/143C12Q2563/107C12Q2521/107C12Q2521/327Y02A50/30
Inventor 朱友杰孔繁平
Owner HANGZHOU YORK BIOTECH CO LTD