Kit and method for isothermal rapid detection of SARS-CoV-2 virus nucleic acid

A detection method and kit technology, applied in the direction of biochemical equipment and methods, microbial measurement/inspection, etc., can solve problems such as expensive synthesis, difficult to achieve multiple detection, and complicated crRNA design

Active Publication Date: 2020-11-13
JIAOHONG BIOTECHNOLOGY (SHANGHAI) CO LTD
View PDF6 Cites 20 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are still problems such as high false positives and poor reliability in the detection of new coronavirus by reverse transcription LAMP method
[0004] Moreover, there are still many limiting factors in the nucleic acid detection technology based on the CRISPR system, such as the limitation of CRISPR on the detection of gene sequences, the difficulty of multiple detection, the relatively complicated design of crRNA and the high cost of synthesis, etc., which are still restrictions on its entry into the market

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit and method for isothermal rapid detection of SARS-CoV-2 virus nucleic acid
  • Kit and method for isothermal rapid detection of SARS-CoV-2 virus nucleic acid
  • Kit and method for isothermal rapid detection of SARS-CoV-2 virus nucleic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0169] Preparation of detection reagent and detection method

[0170] In this embodiment, the SARS-CoV-2 viral nucleic acid isothermal rapid detection kit of the present invention and its use method are provided.

[0171] 1.1 Detection reagents and kits

[0172] In this embodiment, taking the detection of the ORF1b gene of SARS-CoV-2 virus as an example, the corresponding specific target nucleic acid sequence is:

[0173] 5'-ATGCACTTTTCGCATATACAAAACGTAATGTCATCCCTACTATAACTCAA ATGAATCTTAAGTATGCCATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGT GTCTCTATCTGTAGTACTATGACCAATAGACAGTTTCATCAAAAATTATTGAAAT CAATAGCCGCCACTAGAGGAGCTACTGTAGTAATTGGAACAAGCAAATTCTATGGTGGTTGGCACAACATGTTAAAAACTGTTTATAGTGATGTAGAAAACCCTCACC TTATGGGTTGGGATTATCCTAAATGTGATAGAGCCATGCCTAACATGCTTAGAA TTATGGCCTCACTTGTTCTTGCTCGCAAACATACAACGTGTTGTAGCTTGTCACA CCGTTTCTATAGATTAGCTAATGAGTGTGCTCAAGTATTGAGTGAAATGGTCAT GTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCAC AACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAAGCTGTCACGGCCAATGTT AATGCACTTTTATC...

Embodiment 2

[0194] Preparation and detection method of detection reagent (without inner liner)

[0195] In this embodiment, the SARS-CoV-2 viral nucleic acid isothermal rapid detection kit of the present invention and its use method are provided.

[0196] 1.1 Detection reagents and kits

[0197] In this embodiment, the detection of the ORF1b gene of SARS-CoV-2 virus is taken as an example, and the corresponding specific target nucleic acid sequence refers to Example 1.

[0198] Based on the method of the present invention, the corresponding detection reagents include:

[0199] (1), amplification primer, specific sequence is as follows:

[0200]

[0201] (2) Specific guide ssDNA (gDNA), the specific sequence is as follows:

[0202] 2019-nCoV ORF 1b-gDNA 1 5'-P-TTGATGAGGTTCCACC-3' SEQ ID NO.51 2019-nCoV ORF 1b-gDNA 4 5'-P-TCAGTTGTGGCATCTC-3' SEQ ID NO.52

[0203] (3) Fluorescent reporter nucleic acid corresponding to specific guide ssDNA (gDNA), the specifi...

Embodiment 3

[0218] Test for different concentrations of standard substances to be tested

[0219] The standard substance to be tested (SEQ ID NO.: 65) was diluted according to the principle of 3-fold dilution, and diluted to 18000copies / mL, 6000copies / mL, 2000copies / mL, 670copies / mL, 220copies / mL, 70copies / mL As for the standard dilution, draw 140ul standard dilution respectively for nucleic acid extraction (QIAamp ViralRNA Mini Kit). Add 15ul nucleic acid extraction sample, negative control (H2O) and positive control (target fragment plasmid) to the amplification system in Example 2, make 3 groups for each concentration gradient, and do 7 repetitions for each group, and calculate the The detection rate of experiment is carried out by embodiment 3 steps.

[0220] The result is as Figure 4 As shown, 18000copies / mL, 6000copies / mL, 2000copies / mL, and 670copies / mL were all stably detected, and the negative control and positive control were established.

[0221] The results show that the m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit and a method for isothermal rapid detection of SARS-CoV-2 virus nucleic acid. The detection method comprises the following steps: (a) providing a to-be-detected sample containing a target nucleic acid molecule; (b) mixing the to-be-detected sample with a cleavage reagent or a cleavage buffer solution containing the cleavage reagent to form a detection system, wherein the cleavage reagent comprises two guide ssDNAs, a gene editing enzyme (Ago) and a first reporter nucleic acid molecule, the first reporter nucleic acid molecule is provided with a fluorescent group and a quenching group, and the two guide ssDNAs are adjacent to each other; and (c) carrying out fluorescence detection on the detection system so as to obtain a fluorescence signal value, and if the fluorescence signal value is detected in the detection system, indicating that the target nucleic acid molecule exists in the sample, and if the fluorescence signal value is not detected in the detection system, indicating that the target nucleic acid molecule does not exist in the sample. The method provided by the invention can detect the target nucleic acid molecule with high sensitivity and accuracy.

Description

technical field [0001] The invention belongs to the field of biotechnology, specifically, the present invention relates to SARS-CoV-2 viral nucleic acid isothermal rapid detection kit and detection method. Background technique [0002] At present, the accurate and quantitative detection of the new coronavirus, especially the low-abundance virus, has a positive impact on the diagnosis, follow-up control and treatment of patients. Since the release of viral genome sequencing results, the development of detection products for specific nucleic acid sequences has become a focus. So far, the products of seven in vitro diagnostic companies have been put into the market, and more than 20 companies have launched testing products one after another. Real-time fluorescent PCR (reverse transcription PCR) is a clinical standard for detection of COVID-19 viral nucleic acid. Reverse transcription PCR is reverse transcription-polymerase chain reaction. Its principle is to extract the total...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6844
CPCC12Q1/701C12Q1/6844C12Q2563/107Y02A50/30C12Q2521/301C12Q2527/101C12Q1/6806C12Q1/6818
Inventor冯雁李忠磊叶星宇郭翔黄俊刘涛
OwnerJIAOHONG BIOTECHNOLOGY (SHANGHAI) CO LTD