Probe and primer for detecting novel coronavirus SARS-CoV-2, kit, detection method and application

A sars-cov-2, sars-cov-2n technology, applied in the field of probes and primers for the detection of new coronavirus SARS-CoV-2, can solve problems such as increasing the risk of new coronavirus infection, avoid cross-transmission, control Virus outbreak, time saving effect

Active Publication Date: 2020-08-21
HARBIN INST OF TECH
View PDF3 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

On the other hand, false positive test results will cause patients who do not carry the new coronavirus to be misdiagnosed as people infected with the new coronavirus, so they will also greatly increase their subsequent risk of being infected by the new coronavirus during the subsequent centralized isolation period

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probe and primer for detecting novel coronavirus SARS-CoV-2, kit, detection method and application
  • Probe and primer for detecting novel coronavirus SARS-CoV-2, kit, detection method and application
  • Probe and primer for detecting novel coronavirus SARS-CoV-2, kit, detection method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Example 1: Using T7 transcriptase to prepare N and S gene fragments of SARS-CoV-2 new coronavirus as a positive control.

[0067] Submit the S and N gene sequences of the new coronavirus to Langking Biotechnology (Shanghai, China) for gene synthesis. The synthetic new coronavirus N gene sequence is:

[0068] CATATGTCTGATAATGGACCCCAAAATCAGCGAAATGCACCCCGCATTACGTTTGGTGGACCCTCAGATTCAACT GGCAGTAACCAGAATGGAGAACGCAGTGGGGCGCGATCAAAACAACGTCGGCCCCAAGGTTTACCCAATAATAC TGCGTCTTGGTTCACCGCTCTCACTCAACATGGCAAGGAAGACCTTAAATTCCCTCGAGGACAAGGCGTTCCAA TTAACACCAATAGCAGTCCAGATGACCAAATTGGCTACTACCGAAGAGCTACCAGACGAATTCGTGGTGGTGAC GGTAAAATGTAAAAGCTT。

[0069] The synthetic new coronavirus S gene sequence is:

[0070] CATATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTTATTACCCTGACAAAGTTTTTCAGATCCTCAGTTTTCATTCAACTCAGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCCTCTGGGACCAGAGGGTAAACCTA.

[0071] The above N gene and S gene were r...

Embodiment 2

[0074] Embodiment 2. Based on the WEPEAR method, use the exo probe to detect the N gene of the new coronavirus SARS-CoV-2 nucleic acid RNA.

[0075] Regarding the detection of nucleic acid amplification products by using exo probes, it is necessary to design forward primers, reverse primers, and exo probes. The design and working principle of exo probes are as follows image 3 shown. The forward and reverse primers are about 33bp in length (30-35bp), and can amplify fragments with a length of 100-200bp. The characteristic of the exo probe is that there is an alkali-free tetrahydrofuran (THF) residue (idSp) in the middle of the probe, which can be cut by exonuclease III enzyme under appropriate conditions, and there is a base separated from the 5'-side of the THF residue There is a 6-FAM fluorescein-modified thymine T-residue (i6FAMdT), separated by one base on the 3'-side of the THF residue. There is a BHQ1 black hole quencher-modified thymine T-residue (iBHQ1dT ), so there ...

Embodiment 3

[0083] Example 3: Using exo probes to amplify based on the WEPEAR method and RT-ERA Real-time fluorescent quantitative PCR instrument is used to detect the N gene of SARS-CoV-2 in real time.

[0084] In this embodiment, eight tubes with a volume of 250 μl with a transparent flat cover are used for the reaction, and various parameters need to be correctly set in the use of the real-time fluorescent quantitative PCR instrument. The primers, probes and reagents used in the detection process of this example are basically the same as those in Example 2, but the specific operation process has certain changes.

[0085] Specifically, first take an eight-strip tube with a transparent flat cover, add 1 μl of the nucleic acid sample to be tested to the bottom of the eight-strip tube, and at the same time add 2 μl of Mg(OAc) 2 The activator is added to the cap of the eight-tube tube. For a 50 μl reaction system, 2.5 μl of exo forward primer (10 μM), 2.5 μl of exo reverse primer (10 μM), ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a probe, a primer, a kit, and a detection method for detecting novel coronavirus SARS-CoV-2, and application, belongs to the technical field of molecular biology nucleic acid detection technology, and aims to solve problems in field detection, reduce pollution caused in detection process, increase virus RNA detection sensitivity and specificity. The invention provides the probe and the primer for detecting novel coronavirus SARS-CoV-2, and the kit containing the probe and the primer. The invention further provides a whole-course encapsulated procedure for exponential amplification from RNA (WEPEAR method). According to the invention, the detection sensitivity on N gene as low as 1ag (about 4 copies) is realized; the detection sensitivity on S gene as low as 1 copy is achieved, meanwhile, double genes of virus nucleic acid RNA based on RT-RPA (or RT-ERA) are detected at the same time so as to further improve the reliability of the detection result, and the kit can be used for field detection or household detection.

Description

technical field [0001] The invention belongs to molecular biology nucleic acid detection technology, in particular to a probe, primer, kit, detection method and application for detecting the new coronavirus SARS-CoV-2. Background technique [0002] The SARS-CoV-2 virus can cause the acute pneumonia of COVID-19, which can eventually lead to the death of the patient. Since the human-to-human transmission of the new coronavirus has been confirmed by clinical data, in order to better avoid cross-infection, it is urgent to develop accurate, sensitive, and on-site detection methods for the new coronavirus. On January 5, 2019, the RNA gene sequence of the new coronavirus was released, which laid the foundation for the development and identification of new coronavirus detection methods based on nucleic acid sequences. Among them, the reverse transcription-polymerase chain reaction (reverse transcription-polymerase chain reaction, or RT-PCR) detection method is the first effective m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11G01N33/543G01N33/53
CPCC12Q1/6844C12Q1/701C12Q2600/16G01N33/5308G01N33/54313C12Q2521/507C12Q2563/107C12Q2522/101C12Q2521/107C12Q2547/10Y02A50/30
Inventor陈西
OwnerHARBIN INST OF TECH