Artificially synthesized insect-resistant protein mCry1Ia2 as well as preparation method and applications thereof

A technology of artificial synthesis and anti-insect protein, applied in the fields of genetic engineering and biological control, to achieve the effect of reducing usage, broad application prospects and important economic value

Active Publication Date: 2020-11-27
黑龙江大鹏农业有限公司 +1
View PDF15 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The use of a single insect resistance gene often makes the corn borer resistant to Bt protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Artificially synthesized insect-resistant protein mCry1Ia2 as well as preparation method and applications thereof
  • Artificially synthesized insect-resistant protein mCry1Ia2 as well as preparation method and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Example 1 Synthesis of mCry1Ia2 gene

[0058] Through codon optimization, Cry1Ab, Cry1F and Cry1Ie were synthesized (the synthesis work was completed by Jinweizhi (Suzhou) Co., Ltd.), and then by SOE method (1992, Cai Yuyang), the first and second functional domains of Cry1Ab, Cry1F The third functional domain and the three domain fragments of Cry1Ie are spliced ​​together to form a new mCry1Ia2 DNA sequence with six domains, the nucleotide sequence of which is shown in SEQ ID NO.1. It is generally believed that Bt protein is composed of three domains. Domain I includes 250-300 amino acids at the N-terminus of the active insecticidal protein and consists of 7 α-helices, one of which is relatively hydrophobic and is located in the structural domain. The center of I, and the remaining 6 α-helices surround it. It has been shown that it is related to the toxicity of insecticidal proteins. The hydrophobic α-helix has the ability to insert into the midgut cell membrane of se...

Embodiment 2

[0059] Example 2 Expression of mCry1Ia2 gene in prokaryotic system and toxicity detection of product

[0060] In order to detect the in vitro expression of the modified mCry1Ia2 gene and its toxicity to corn borer, we constructed a Bt prokaryotic expression vector. As needed, add the NdeI endonuclease recognition site sequence AAGGAGATATACATA at the 5' end of the primer sequence, as shown in SEQ ID NO.3; add the XhoI endonuclease recognition site sequence GGTGGTGGTGCTCGAG at the 3' end, as shown in SEQ ID NO.4 shown. The designed primer sequence is: F: AAGGAGATATACATA TGGACAACAACCCCAAC, as shown in SEQ ID NO. 5; R: GGTGGTGGTGCTCGAG CATGTCCCGCTGCTCGAT, as shown in SEQ ID NO.6. Using the spliced ​​DNA as a template, the mCry1Ia2 gene was amplified with primers added with adapters, and the mCry1Ia2 gene fragment was recovered and purified with a gel recovery kit. The pET30a was digested with restriction enzymes NdeI and XhoI, and recovered and purified. The two fragments w...

Embodiment 3

[0072] Example 3 Expression of mCry1Ia2 gene in transgenic plants and toxicity detection of expression products

[0073] At the 5' and 3' ends of the primer sequences, SmaI endonuclease recognition site sequences CTCTAGAGGATCCCC, as shown in SEQ ID NO. 7; and TCGAGTCGGTACCC, as shown in SEQ ID NO. 8, were added respectively. Design primers: F: 5' CTCTAGAGG ATCCCC ATGGACAACAACCCCAAC3', as shown in SEQ ID NO. 9; R: 5' TCGAGCTCGGTACCC CTACTACTCGAGTGTGGCAGT 3', as shown in SEQ ID NO. 10, took the synthesized mCry1Ia2 nucleotide sequence as a template, amplified with primers with adapters, and recovered the target fragment with a gel recovery and purification kit. At the same time, the plant expression vector pTF101 was digested with SmaⅠ, and the pTF101 fragment after the digestion was recovered and purified. The two fragments were ligated (In-Fusion HD cloning kit, Clontech) to construct a eukaryotic expression plasmid pTF101-mCry1Ia2 (the promoter is CaMV35S, and the marke...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses artificially synthesized insect-resistant protein mCry1Ia2. The invention also discloses a nucleic acid molecule of the protein, and a recombinant vector, a host cell or a recombinant bacterium of the nucleic acid molecule. The invention also discloses applications of the protein, the nucleic acid molecule and the recombinant vector of the nucleic acid molecule, the host cell or the recombinant bacteria to regulation and control of plant insect resistance, insect killing or improvement in insect resistance of transgenic plants, and preparation of insecticides or insectcontrol preparations. In vitro experiments show that the modified Bt toxin-producing protein has higher insecticidal activity against ostrinia nubilalis, and has significant insecticidal effect on thepopulation of ostrinia nubilalis resistant to Cry1Ab, Cry1F and Cry1Ie toxin protein. A novel plant expression vector is constructed by a constitutive promoter, and the insect-resistant gene mCry1Ia2can be stably and efficiently expressed in monocotyledonous plants to be further used for producing the insect-resistant transgenic plants.

Description

technical field [0001] The invention relates to the fields of genetic engineering and biological control, in particular to an artificially synthesized insect-resistant protein mCry1Ia2 and a preparation method and application thereof. Background technique [0002] The Bt gene encodes an insecticidal crystal protein from Bacillus thuringiensis, which is widely present in water, soil, desert, leaves, and insect carcasses, and is currently the most productive and widely used bioinsecticide. When it forms spores, it can form insecticidal crystal protein (ICP), also known as delta-endotoxin, which can produce specific insecticidal activity against agricultural pests such as Lepidoptera and Coleoptera. Its action process includes the ingestion of protoxin by insects, the enzymatic hydrolysis and activation of protoxin, the toxin passing through the peritrophic membrane, the binding of toxin to specific receptors, the embedding of toxin molecules into the epidermal cell membrane, t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/70C12N1/21A01N47/44A01P7/04C12N15/82A01H5/00A01H6/46C12R1/19
CPCC07K14/325C12N15/70A01N47/44C12N15/8286C07K2319/00C12N2800/22Y02A40/146
Inventor于壮岳莉莉
Owner黑龙江大鹏农业有限公司