Supercharge Your Innovation With Domain-Expert AI Agents!

Primer probe set for rapidly and efficiently detecting candida aurantiaca based on fluorescent PCR technology as well as kit and application thereof

A primer-probe, Candida technology, applied in recombinant DNA technology, microbial determination/inspection, biochemical equipment and methods, etc., can solve the problem of long target amplification fragment length and other problems, achieve short time consumption and strong specificity The effect of amplification characteristics and high detection sensitivity

Pending Publication Date: 2020-12-11
杭州缔园生物技术有限公司
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

All of the above patents can accurately distinguish Candida auris from similar strains, but there is also the defect that the length of the target amplified fragment is relatively long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer probe set for rapidly and efficiently detecting candida aurantiaca based on fluorescent PCR technology as well as kit and application thereof
  • Primer probe set for rapidly and efficiently detecting candida aurantiaca based on fluorescent PCR technology as well as kit and application thereof
  • Primer probe set for rapidly and efficiently detecting candida aurantiaca based on fluorescent PCR technology as well as kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] The composition of the kit for rapid and efficient detection of Candida auris based on fluorescent PCR technology is shown in Table 1.

[0059] Table 1 Composition of the kit

[0060]

[0061]

[0062] See Table 2 for information on the upstream and downstream primers and probes for amplifying the specific DNA fragments of Candida auris and the primer pairs and probes for amplifying the internal reference.

[0063] Table 2 Information of upstream and downstream primers and probes in the kit

[0064] Primer name Numbering Primer sequence (5'--3') Amplified Candida auris-specific forward primer SEQ ID NO:2 ATGCCTGTTTGAGCGTGATG Amplified Candida auris-specific reverse primer SEQ ID NO:3 CGTGCAAGCTGTAATTTTGTGAA Candida auris probe SEQ ID NO:4 ACCAATCTTCGCGGTGGCGTTG Amplify the internal reference-specific forward primer SEQ ID NO:5 CAAAGGCCAGGCTGTAAATGTC Amplified Internal Reference Specific Reverse Primer SEQ ID...

Embodiment 2

[0066] Detection method of the kit

[0067] Before using this kit for detection, it is necessary to extract the DNA of the sample to be tested, and the DNA can be extracted with the DNA extraction or purification kit.

[0068] 1. Preparation of PCR reaction tubes (reagent preparation area)

[0069] (1) Determine the number of reaction tubes n (number of samples + negative control + positive control); take out sterilized purified water (prepared by the user) and PCR reaction solution; take out other components in the kit, put them on ice or Thaw at room temperature. All kit components require brief centrifugation before use. Each reaction system is shown in Table 3:

[0070] Table 3 Fluorescence PCR reaction system

[0071] PCR reaction solution Primer probe Sterilized purified water Sample / Control total capacity 10μL 1μL 0.5μL 4.5μL 4μL 20 μL

[0072] Calculate the amount of each of the above reagents (except the sample / control subst...

Embodiment 3

[0096] Identification of strains

[0097] In order to ensure the accuracy of the research, the samples of 8 different Candida auris cultured strains used in the experiment were sequenced and verified. The sequencing was aimed at the ITS region, and the sequencing primers for the ITS region were as follows:

[0098] ITS1: 5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID NO: 14;

[0099] ITS4: 5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID NO:15.

[0100] The sequencing results were compared in the NCBI database, and 5 strains were Candida auris, 1 was Candida tropicalis, 1 was Pichia pastoris, and the last one was not a fungus. The above results are completely consistent with the results detected by the Candida auris kit of the present invention, indicating that the method and the kit have good specificity.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer probe set for rapidly and efficiently detecting candida aurantiaca based on fluorescent PCR technology as well as a kit and application thereof, and belongs to the technical field of pathogenic microorganism in-vitro molecules. The invention relates to a specific DNA fragment for detecting the candida aurantiaca, wherein the DNA fragment has a nucleotide sequence shown as SEQ ID NO: 1. The primer probe set for rapidly and efficiently detecting the candida aurantiaca based on the fluorescent PCR technology comprises a primer pair, and a probe; the primer pair consists of a forward primer with a nucleotide sequence as shown in SEQ ID NO: 2, and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 3; and the probe has a nucleotide sequence as shown in SEQ ID NO: 4. The primer probe set and the kit thereof are capable of rapidly and efficiently detecting the candida aurantiaca on basis of the fluorescent PCR technology; and thus, high detectionsensitivity, short detection time and simple operation can be realized.

Description

technical field [0001] The invention belongs to the technical field of in vitro molecules of pathogenic microorganisms, and specifically relates to a primer probe set, a kit and an application thereof for rapid and efficient detection of Candida auris based on fluorescent PCR technology. Background technique [0002] Candida auris is a newly discovered multidrug-resistant fungus. Invasive candidiasis is mainly caused by Candida albicans, which is gradually changing to non-Candida albicans. Candida auris is multidrug-resistant and conventional fungal treatment can be problematic. Candida auris found in the United States is not only highly resistant to the classic antifungal drug - fluconazole, but more than 50% of the strains are resistant to voriconazole, and about 1 / 3 of the strains are resistant to amphotericin B, which is common in clinical Amphotericin B resistance is very rare among Candida species, making this strain even more of a concern. Despite the strengthening...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/686C12Q1/04C12N15/11
CPCC12Q1/6895C12Q1/686C12Q2600/166C12Q2563/107C12Q2545/101C12Q2545/113
Inventor 李萌方园张人友任云
Owner 杭州缔园生物技术有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More