Primer probe set for rapidly and efficiently detecting candida aurantiaca based on fluorescent PCR technology as well as kit and application thereof
A primer-probe, Candida technology, applied in recombinant DNA technology, microbial determination/inspection, biochemical equipment and methods, etc., can solve the problem of long target amplification fragment length and other problems, achieve short time consumption and strong specificity  The effect of amplification characteristics and high detection sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
 AI Technical Summary 
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] The composition of the kit for rapid and efficient detection of Candida auris based on fluorescent PCR technology is shown in Table 1.
[0059] Table 1 Composition of the kit
[0060]
[0061]
[0062] See Table 2 for information on the upstream and downstream primers and probes for amplifying the specific DNA fragments of Candida auris and the primer pairs and probes for amplifying the internal reference.
[0063] Table 2 Information of upstream and downstream primers and probes in the kit
[0064] Primer name Numbering Primer sequence (5'--3') Amplified Candida auris-specific forward primer SEQ ID NO:2 ATGCCTGTTTGAGCGTGATG Amplified Candida auris-specific reverse primer SEQ ID NO:3 CGTGCAAGCTGTAATTTTGTGAA Candida auris probe SEQ ID NO:4 ACCAATCTTCGCGGTGGCGTTG Amplify the internal reference-specific forward primer SEQ ID NO:5 CAAAGGCCAGGCTGTAAATGTC Amplified Internal Reference Specific Reverse Primer SEQ ID...
Embodiment 2
[0066] Detection method of the kit
[0067] Before using this kit for detection, it is necessary to extract the DNA of the sample to be tested, and the DNA can be extracted with the DNA extraction or purification kit.
[0068] 1. Preparation of PCR reaction tubes (reagent preparation area)
[0069] (1) Determine the number of reaction tubes n (number of samples + negative control + positive control); take out sterilized purified water (prepared by the user) and PCR reaction solution; take out other components in the kit, put them on ice or Thaw at room temperature. All kit components require brief centrifugation before use. Each reaction system is shown in Table 3:
[0070] Table 3 Fluorescence PCR reaction system
[0071] PCR reaction solution Primer probe Sterilized purified water Sample / Control total capacity 10μL 1μL 0.5μL 4.5μL 4μL 20 μL
[0072] Calculate the amount of each of the above reagents (except the sample / control subst...
Embodiment 3
[0096] Identification of strains
[0097] In order to ensure the accuracy of the research, the samples of 8 different Candida auris cultured strains used in the experiment were sequenced and verified. The sequencing was aimed at the ITS region, and the sequencing primers for the ITS region were as follows:
[0098] ITS1: 5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID NO: 14;
[0099] ITS4: 5'-TCCGTAGGTGAACCTGCGG-3', SEQ ID NO:15.
[0100] The sequencing results were compared in the NCBI database, and 5 strains were Candida auris, 1 was Candida tropicalis, 1 was Pichia pastoris, and the last one was not a fungus. The above results are completely consistent with the results detected by the Candida auris kit of the present invention, indicating that the method and the kit have good specificity.
PUM
 Login to View More
 Login to View More Abstract
Description
Claims
Application Information
 Login to View More
 Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



