Lactoferrin aptamer affinity column as well as preparation method and application thereof
A lactoferrin and aptamer technology, applied in biochemical equipment and methods, instruments, analytical materials, etc., can solve the problems of non-immunogenicity, achieve low price, high efficiency, and reduce cross-reaction effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1 Screening and affinity determination of lactoferrin nucleic acid aptamers
[0054] SELEX technology was used to select nucleic acid aptamers with high affinity to the target lactoferrin (LF) in vitro. The sequences of the three candidate LF aptamers were as follows (5′-3′):
[0055] LAC1: TCAAGCAGTGCAATTGCAGTATGTTGTTGTGGTGTT
[0056] LAC6: TCAATGTCCCGATGCAGTCTAACTGTGTTGAGATGT
[0057] LAC9: TCAATATGCCCCCCCAATGCAGTTGGTCCGGTATGT
[0058] The affinities of the three candidate LF aptamers were determined by SPR (see He Xiaoqin for specific methods. Post-SELEX screening evaluation, characterization and new sensing methods of aptamers. Academy of Military Medical Sciences of the Chinese People's Liberation Army, 2017). See the test results image 3 .
[0059] It can be seen that the three aptamers have different affinities to lactoferrin. Further accurate determination of the affinity of LAC1, the affinity reached 372pM ( Figure 4 ).
Embodiment 2
[0060] Example 2 Preparation of Aptamer Affinity Column and Condition Optimization
[0061] 1. Washing of the carrier: Take 300 μL of N-hydroxysuccinimide (-NHS) modified agarose in a 2 mL centrifuge tube, wash with 1 mM hydrochloric acid twice, 1 mL each time;
[0062] 2. Aptamer refolding: Dissolve 1OD of 5’ amino-modified lactoferrin aptamer-specific DNA in 500 μL MES buffer, refold at 95°C for 5 minutes, and then place at room temperature for 30 minutes;
[0063] 3. Coupling: Add the refolded aptamer solution to the washed carrier, and shake it on a shaking table at 25°C for 0.5h;
[0064] 4. Blocking: After the coupling product was centrifuged to remove the supernatant, 1 mL of blocking buffer was added, and the reaction was shaken on a shaker at 25°C for 1 hour to obtain the carrier-aptamer filler;
[0065] 5. Washing: Wash the above-mentioned carrier-aptamer filler twice with washing buffer to remove uncoupled aptamers. The washed conjugated gel was resuspended with 1...
Embodiment 3
[0083] Example 3 Purification and detection of lactoferrin in milk samples using a lactoferrin aptamer affinity column
[0084] In this example, a lactoferrin standard substance was quantitatively added to a commercially available milk sample, and then the lactoferrin aptamer affinity column prepared in Example 1 was used for purification. After purification, it was detected by high performance liquid chromatography to determine the recovery rate. details as follows:
[0085] 1. Weigh 10g of liquid milk (accurate to 0.01g), add phosphate extract to make up to 50mL, mix well, centrifuge at 10000rpm, 4°C for 15min, absorb the supernatant to be purified. The lactoferrin aptamer affinity column was first activated with 5mL binding buffer, then accurately pipette 10mL supernatant through the column, washed with 10mL elution buffer, eluted with 2mL phosphate eluent, and collected the eluted solution, dilute to 2mL with phosphate eluent, vortex and mix well, and pass through a micro...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com