Lactoferrin aptamer affinity column as well as preparation method and application thereof

A lactoferrin and aptamer technology, applied in biochemical equipment and methods, instruments, analytical materials, etc., can solve the problems of non-immunogenicity, achieve low price, high efficiency, and reduce cross-reaction effects

Active Publication Date: 2020-12-22
BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

As a new type of molecule that is artificially synthesized in vitro and has similar functions to antibodies, its research is still in its infancy compared with mainstream ...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lactoferrin aptamer affinity column as well as preparation method and application thereof
  • Lactoferrin aptamer affinity column as well as preparation method and application thereof
  • Lactoferrin aptamer affinity column as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Screening and affinity determination of lactoferrin nucleic acid aptamers

[0054] SELEX technology was used to select nucleic acid aptamers with high affinity to the target lactoferrin (LF) in vitro. The sequences of the three candidate LF aptamers were as follows (5′-3′):

[0055] LAC1: TCAAGCAGTGCAATTGCAGTATGTTGTTGTGGTGTT

[0056] LAC6: TCAATGTCCCGATGCAGTCTAACTGTGTTGAGATGT

[0057] LAC9: TCAATATGCCCCCCCAATGCAGTTGGTCCGGTATGT

[0058] The affinities of the three candidate LF aptamers were determined by SPR (see He Xiaoqin for specific methods. Post-SELEX screening evaluation, characterization and new sensing methods of aptamers. Academy of Military Medical Sciences of the Chinese People's Liberation Army, 2017). See the test results image 3 .

[0059] It can be seen that the three aptamers have different affinities to lactoferrin. Further accurate determination of the affinity of LAC1, the affinity reached 372pM ( Figure 4 ).

Embodiment 2

[0060] Example 2 Preparation of Aptamer Affinity Column and Condition Optimization

[0061] 1. Washing of the carrier: Take 300 μL of N-hydroxysuccinimide (-NHS) modified agarose in a 2 mL centrifuge tube, wash with 1 mM hydrochloric acid twice, 1 mL each time;

[0062] 2. Aptamer refolding: Dissolve 1OD of 5’ amino-modified lactoferrin aptamer-specific DNA in 500 μL MES buffer, refold at 95°C for 5 minutes, and then place at room temperature for 30 minutes;

[0063] 3. Coupling: Add the refolded aptamer solution to the washed carrier, and shake it on a shaking table at 25°C for 0.5h;

[0064] 4. Blocking: After the coupling product was centrifuged to remove the supernatant, 1 mL of blocking buffer was added, and the reaction was shaken on a shaker at 25°C for 1 hour to obtain the carrier-aptamer filler;

[0065] 5. Washing: Wash the above-mentioned carrier-aptamer filler twice with washing buffer to remove uncoupled aptamers. The washed conjugated gel was resuspended with 1...

Embodiment 3

[0083] Example 3 Purification and detection of lactoferrin in milk samples using a lactoferrin aptamer affinity column

[0084] In this example, a lactoferrin standard substance was quantitatively added to a commercially available milk sample, and then the lactoferrin aptamer affinity column prepared in Example 1 was used for purification. After purification, it was detected by high performance liquid chromatography to determine the recovery rate. details as follows:

[0085] 1. Weigh 10g of liquid milk (accurate to 0.01g), add phosphate extract to make up to 50mL, mix well, centrifuge at 10000rpm, 4°C for 15min, absorb the supernatant to be purified. The lactoferrin aptamer affinity column was first activated with 5mL binding buffer, then accurately pipette 10mL supernatant through the column, washed with 10mL elution buffer, eluted with 2mL phosphate eluent, and collected the eluted solution, dilute to 2mL with phosphate eluent, vortex and mix well, and pass through a micro...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a lactoferrin aptamer affinity column as well as a preparation method and application thereof. The affinity column takes agarose modified by N-hydroxysuccinimide as a carrier, anucleic acid aptamer capable of recognizing lactoferrin with high affinity and high specificity is covalently coupled with the carrier, and a solid-phase extraction column is filled with a specific affinity filler after coupling. The affinity column is mainly applied to specific recognition and enrichment purification of lactoferrin in a sample, the natural activity of lactoferrin can still be kept after purification, the method is rapid, simple, convenient and accurate, the affinity column can be repeatedly used, and the affinity column can be used for sample pretreatment before detection ofa large instrument and can also be used for separation and purification of lactoferrin. Wide application prospects are realized in the fields of cosmetics, food, animal production, medical treatmentand the like.

Description

technical field [0001] The invention belongs to the technical field of biological detection, and in particular relates to a lactoferrin aptamer affinity column and its preparation method and application. Background technique [0002] Lactoferrin (Lactoferrin, LF) is a non-heme iron-binding protein with a relative molecular weight of about 80KDa, which mainly exists in the milk of mammals, especially the content of lactoferrin in colostrum is relatively high. Lactoferrin has a variety of biological functions. It can not only regulate iron transfer in the human body, promote bone growth, but also have antibacterial, antiviral, antioxidative, and immune regulation functions. At present, it has been considered as a safe food additive, widely used in dairy products and related infant formula food, special medical purpose formula food, health food and medicine and other fields. But so far there is no national testing standard for lactoferrin. Commonly used lactoferrin detection ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): G01N30/06G01N30/08C12N15/115G01N33/68
CPCG01N30/06G01N30/08C12N15/115G01N33/68G01N2030/062G01N2030/085C12N2310/16G01N2333/79
Inventor 栾云霞陆安祥郭晓军
Owner BEIJING ACADEMY OF AGRICULTURE & FORESTRY SCIENCES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap