SlugCas9-HF protein, gene editing system containing SlugCas9-HF protein and application thereof

A gene editing, cas9-hf technology, applied in applications, genetic engineering, plant genetic improvement, etc., can solve problems such as ineffective packaging, complex PAM sequences, and limited applications

Active Publication Date: 2021-01-01
FUDAN UNIV
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the SpCas9 protein has 1368 amino acids, plus sgRNA and promoter, cannot be effectively packaged into AAV virus, which limits its clinical application
To overcome this problem, several small Cas9s have been invented, including SaCas9 (PAM sequence is NNGRRT); St1Cas9 (PAM sequence is NNAGAW); NmCas9 (PAM sequence is NNNNGATT); Nme2Cas9 (PAM sequence is NNNNCC); The PAM sequence is NNNNRYAC), but these Cas9s are either easy to off-target (that is, cut at non-target sites), or the PAM sequence is complex, or the editing activity is low, and it is difficult to be widely used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SlugCas9-HF protein, gene editing system containing SlugCas9-HF protein and application thereof
  • SlugCas9-HF protein, gene editing system containing SlugCas9-HF protein and application thereof
  • SlugCas9-HF protein, gene editing system containing SlugCas9-HF protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] A CRISPR / Cas9-HF gene editing system, comprising SlugCas9-HF protein and sgRNA, the sgRNA is respectively adding 21 bases AGAGTAGGCTGGTAGATGGAG, GTCAGACATGAGATCACAGAT at the front end of the nucleotide sequence shown in SEQ ID NO:3, The sequences of the obtained nucleotide sequence M are specifically shown in SEQ ID NO:5 and SEQ ID NO:6.

[0086] The application of the above-mentioned CRISPR / Cas9-HF gene editing system to gene editing of targeted DNA in HEK293T cells containing targeted DNA, specifically includes the following steps:

[0087] (1), construction of plasmid pAAV2_SlugCas9-HF_ITR

[0088] ①According to the retrieval number A0A133QCR3 of the SlugCas9 gene on UniProt, download its amino acid sequence, and make R247A, N415A, T421A, R656A mutations. After the mutation, the amino acid sequence encoding the SlugCas9-HF protein is shown as SEQ ID NO:1;

[0089] ② Codon-optimizing the amino acid sequence encoding the SlugCas9-HF protein obtained above to obtain a ...

Embodiment 2

[0130] A CRISPR / Cas9-HF gene editing system, including SlugCas9-HF protein and sgRNA (hereinafter referred to as On-target sgRNA, to distinguish it from mismatch sgRNA), and also includes sgRNA containing different base mismatches, namely mismatchsgRNA;

[0131] The SlugCas9-HF protein has the amino acid sequence shown in SEQ ID NO:1;

[0132] The On-target sgRNA is a nucleotide sequence M obtained by adding 21 bases (GGCTCGGAGATCATCATTGCG) to the front of the nucleotide sequence shown in SEQ ID NO: 3, specifically referring to SEQ ID NO: 7.

[0133] Using one of the above-mentioned CRISPR / Cas9-HF gene editing systems to detect its specificity in the GFP reporter system HEK293T cell line containing targeted DNA, and then count the percentage of GFP-positive cells to calculate the editing efficiency and off-target rate, specifically including the following steps:

[0134] (1), construct the plasmid pAAV2_SlugCas9-HF_ITR, the same as the step (1) of Example 1, until the plasmid pA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of gene editing, and particularly discloses a SlugCas9HF-protein, a recombinant vector containing the protein, a CRISPR / Cas9-HF gene editing system, application and the like. The SlugCas9-HF protein has the amino acid sequence shown in SEQ ID NO:1 or is at least 80% identical to SEQ ID NO:1 and retains at least one or more of R247A, N415A, T421A and R656A mutations, and the recombinant vector containing the protein is obtained by connecting a gene sequence encoding amino acid of the SlugCas9-HF protein to a base vector. The CRISPR / Cas9-HF gene editing system is composed of SlugCas9-HF protein and sgRNA, which can edit target genes with high specificity and high editing efficiency, and the off-target rate is within 2.87%.

Description

technical field [0001] The application belongs to the technical field of gene editing, and specifically relates to a SlugCas9-HF protein, a gene editing system containing the SlugCas9-HF protein, and related applications. Background technique [0002] CRISPR / Cas9 is an adaptive immune system evolved by bacteria and archaea to resist the invasion of foreign viruses or plasmids. In the CRISPR / Cas9 system, after crRNA (CRISPR-derived RNA), tracrRNA (trans-activating RNA) and Cas9 protein form a complex, they recognize the PAM (Protospacer AdjacentMotif) sequence of the target site, and crRNA will form a complex with the target DNA sequence. Complementary structure, Cas9 protein performs the function of cutting DNA, causing DNA breakage and damage. Wherein, tracrRNA and crRNA can be fused into a single-stranded guide RNA (singleguide RNA, sgRNA) through a linking sequence. When DNA is broken and damaged, two main DNA damage repair mechanisms in cells are responsible for repair...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/22C12N15/55C12N15/113C12N15/864
CPCC12N9/22C12N15/113C12N15/86C12N2310/20C12N2750/14143C12N2800/22
Inventor王永明胡子英王帅高思琪
OwnerFUDAN UNIV