Construction method of high-yield ectoine engineering strain and application thereof

A technology of tetrahydropyrimidine and engineering bacteria, applied in the field of bioengineering, can solve problems such as affecting the production of tetrahydropyrimidine, and achieve the effects of avoiding pressure and saving costs

Pending Publication Date: 2021-01-29
JIANGNAN UNIV +1
View PDF4 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the bacterium did not modify the heterologous gene cluster ectABC, which limited the further increase of ectoine production to a certain extent; at the same time, the bacterium was an amino acid-deficient bacterium, which would inhibit the growth of the bacterium to a certain extent and cause damage to the bacterium. A certain pressure, which in turn affects the production of ectoine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of high-yield ectoine engineering strain and application thereof
  • Construction method of high-yield ectoine engineering strain and application thereof
  • Construction method of high-yield ectoine engineering strain and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1: Construction of recombinant plasmid pRSFDuet-1-ectABC

[0049] (1) Extract the genome of Halomonas elongata, and design primers ectABC-F / ectABC-R (ectABC-F: ggccggccgatatccaattgagatctgccgctacagcgaaccacgacaatgaac; ectABC-R: gcggtttctttaccagactcgagggtaccgttacagcggcttctggtcgtcggcttcg), using the genome elongation as the template Use primers to carry out PCR to amplify and obtain the target gene fragment ectABC (shown in SEQ ID NO.1) with the original RBS sequence;

[0050] (2) Extract plasmid pRSFDuet-1, whose nucleotide sequence is SEQ ID NO.7, and design primers pRSFDuet-1-F1 / pRSFDuet-1-R1 (pRSFDuet-1-F1: cggtaccctcgagtctggtaaagaaaccgctgctgcgaaatttgaac; pRSFDuet-1-R1: ggccggccgatatccaattgagatctgccatatgtatct ), using the plasmid pRSFDuet-1 as a template, performing PCR amplification to obtain the linearized vector pRSFDuet-1 at the expression cassette of the first T7 promoter;

[0051] (3) Ligate the fragments obtained in steps (1) and (2) with a one-step clon...

Embodiment 2

[0052] Embodiment 2: Construction of recombinant bacterial strain E / pR-ABC and shake flask horizontal culture

[0053] (1) Preparation of CaCl 2 Solution:

[0054] (2) Pick a single colony of E.coli BL21(DE3) from the LB plate, inoculate it in 5ml LB liquid medium, and cultivate it overnight at 37°C and 220rpm;

[0055] (3) Transfer the bacterial solution to a 250mL shake flask containing 50ml LB liquid medium at 2%, and cultivate it at 37°C and 220rpm until OD600=0.4-0.6;

[0056] (4) Place on ice for 15 minutes, then centrifuge at 4000 rpm, 4°C for 10 minutes to collect the bacteria;

[0057] (5) Resuspend the bacteria in CaCl after ice bath 2 Solution, after standing for 30min, centrifuge at 4000rpm, 4°C for 10min;

[0058] (6) Discard the supernatant and re-add 1-2mL CaCl 2 Solution, mix well, dispense 50-100μL per tube into 1.5ml sterilized centrifuge tubes, store at -80°C or perform transformation;

[0059] (7) The recombinant plasmid pR-ABC obtained in Example 1 w...

Embodiment 3

[0065] Embodiment 3: construct recombinant plasmid R-A, R-B and R-C

[0066] 设计引物EctA-F / EctA-R(EctA-F:gtataagaaggagatatacataatgaacgcaaccacagagccctttacaccc;EctA-R:ctctgtggttgcgttcattatgtatatctccttcttatacttaactaatatac),EctB-F / EctB-R(EctB-F:aaggaggaaaatatccacaggaggtcgcaatgca;EctB-R:gtggatattttcctccttcgtcccggctcagatctggtc),EctC-F / EctC- R (EctC-F: aaggaggaaaatatcgacatgatcgttcgcaatctcg; EctC-R: gtcgatattttcctcctttcagctaaaggcctgcttggtg), the recombinant vector pR-ABC was used as a template to carry out circularization PCR, and the genes ectA, ectB and ectC were subjected to RBS sequence replacement respectively to obtain a single-gene RBS sequence replacement recombinant vector R-A, R-B and R-C, wherein the RBS sequence of ectA is replaced by the RBS sequence behind the T7 promoter on the vector pRSFDuet-1 (as shown in 287~300bp of SEQID NO.7), named R-A; the RBS sequences of ectB and ectC are both Replaced with the nucleotide sequence shown in SEQ ID NO.11, the resulting recombinant...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of a high-yield ectoine engineering strain and an application thereof, and belongs to the technical field of bioengineering. The present invention provides an E.coli BL21 (DE3) recombinant bacterium capable of producing ectoine under low salt conditions, the bacterium comprising exogenous genes ectA, ectB and ectC having a specific RBS sequence controlled by a T7 promoter, and post-transcriptional level inhibition of ptsG, pta, thrA and lysA genes using a sRNA technology. The recombinant escherichia coli constructed by the invention takes glucose as a substrate, and after fermentation is carried out for 72 hours, the tetrahydropyrimidine yield can reach 30g / L.

Description

technical field [0001] The invention relates to a construction method and application of a high-yielding ectoine engineering strain, belonging to the technical field of bioengineering. Background technique [0002] Ectoine is a polar, soluble, uncharged small molecule organic substance within the physiological pH range, and belongs to the compatible solute. Studies have shown that ectoine is the most common regulator of osmolarity in aerobic moderately halophilic bacteria; positively affects the conformation and activity of proteins; is critical for bacterial cells in extreme environments (drought, freezing, high salinity, high temperature , radiation, etc.) to protect nucleic acids, proteins, enzymes, etc.; widely used in medicine, cosmetics, enzyme industry and other fields. [0003] There are two main methods for the synthesis of ectoine: chemical synthesis and biosynthesis. Among them, the biosynthesis method mainly adopts enzyme catalysis method and fermentation metho...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12N15/54C12N15/60C12P17/12C12R1/19
CPCC12N15/52C12N9/1217C12N9/1029C12N9/1096C12N9/88C12N15/70C12P17/12C12Y207/02004C12Y203/01178C12Y206/01C12Y402/01108Y02A50/30
Inventor康振陈坚堵国成戴跃锋何广文颜少尉魏伟伟
OwnerJIANGNAN UNIV