Nested recombinase-polymerase amplification method and application thereof

A recombinase and polymerase technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of increasing the risk of product diffusion pollution, the need to improve the sensitivity and stability, and increasing the operation time and difficulty, etc. Achieve the effect of ensuring primer concentration level, reducing primer concentration consumption, and reducing operational complexity

Pending Publication Date: 2021-03-12
TSINGHUA UNIV
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] 1. The entire reaction requires two tubes of RPA reagents, which doubles the cost of the reagents
[0008] 2. Nested RPA needs to prepare two reactions separately, which increases operation time and difficulty, making it difficult to automate
[0009] 3. Nested RPA needs to absorb and transfer reaction products in the middle, which increases the risk of product diffusion pollution
[0010] 4. Nested RPA only adds a small amount of the first step product to the second step reaction, and the sensitivity and stability of the reaction need to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nested recombinase-polymerase amplification method and application thereof
  • Nested recombinase-polymerase amplification method and application thereof
  • Nested recombinase-polymerase amplification method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Embodiment 1 studies the change of effective primer concentration in the RPA reaction process

[0058] 1. Preparation of reagents and instruments

[0059] SARS-Cov2 virus RNA samples were purchased from national standard materials (standard material number: GBW(E)091099.

[0060] The RPA reaction kit was purchased from TwistDX Company in the UK, and the product model was Twist Basic RT kit

[0061] 2X RNA loading dye was purchased from Thermo Fisher, the product number is R0641

[0062] SYBR gold dye was purchased from thermo fisher company, the product number is S11494

[0063] Multifunctional fluorescence imager, model: Typhoon FLA9500

[0064] 2. Experimental steps

[0065] 1) Dilute the RNA of the new coronavirus to 500copies / ul according to the concentration of the E gene.

[0066] 2) Dilute the new coronavirus E gene primer to 10Um with DEPC water. The primer sequences are as follows:

[0067] E-Primer F: TTCTTTTTCTTGCTTTCGTGGTATTCTTGC (SEQ ID NO: 3)

[...

Embodiment 2

[0084] ATP concentration change in the research RPA reaction process of embodiment 2

[0085] 1. Preparation of reagents and instruments

[0086] SARS-Cov2 virus RNA samples were purchased from national standard materials (standard material number: GBW(E)091099.

[0087] The RPA reaction kit was purchased from TwistDX Company in the UK, and the product model was Twist Basic RT kit

[0088] Enhanced ATP detection kit was purchased from Biyuntian Biotechnology Co., Ltd., item number: S0027

[0089] Multifunctional microplate reader, model: TECAN spark

[0090] 2. Experimental steps:

[0091] 1) Dilute the RNA of the new coronavirus to 500copies / ul according to the concentration of the E gene.

[0092] 2) Dilute the new coronavirus E gene primer to 10uM with DEPC water.

[0093] The primer sequences are as follows:

[0094] E-Primer F:

[0095] TTCTTTTTCTTGCTTTCGTGGTATTCTTGC (SEQ ID NO: 3)

[0096] E-Primer:

[0097] TAMRA-AGAATTCAGATTTTTAACACGAGAGTAAACGT (SEQ ID NO: 4) ...

Embodiment 3

[0115] Example 3 Study on the effect of adding two pairs of primers in the middle of the RPA reaction on the amplification efficiency

[0116] 1. Preparation of reagents and instruments

[0117] The SARS-Cov2 virus RNA sample was purchased from the national standard material (standard material number: GBW(E) 091099. The RPA reaction kit was purchased from the TwistDX company in the UK, and the product model was Twist Basic RT kit colloidal gold test strips were purchased from Beijing Kuer Technology Co., Ltd.

[0118] 2. Experimental steps

[0119] 1) Dilute the RNA of the new coronavirus to 10copies / ul according to the concentration of the E gene.

[0120] 2) Dilute the new coronavirus E gene primer to 10uM with DEPC water. The primer sequences are as follows:

[0121] E-Primer F: ATGTACTCATTCGTTTCGGAAGAGACAGG (SEQ ID NO: 1)

[0122] E-primer R: AGACCAGAAGATCAGGAACTCTAGAAGAA (SEQ ID NO: 2)

[0123] E-2 nd primer F: TTCTTTTTCTTGCTTTCGTGGTATTCTTGC (SEQ ID NO: 3)

[012...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a rapid and high-sensitivity nested recombinase polymerase amplification detection method, a related nucleic acid rapid detection method and a nested recombinase polymerase amplification detection kit. According to the present invention, nucleic acid can be rapidly detected with high sensitivity, two reaction reagents do not need to be prepared during the reaction process,and the reaction product capable of carrying out sensitive detection can be obtained through the direct reaction, such that the nucleic acid detection operation steps are substantially simplified, the operation complexity is reduced, and the sensitivity is improved.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a fast and highly sensitive nested recombinase-polymerase amplification detection method, a related nucleic acid rapid detection method, and a nested recombinase-polymerase amplification detection kit. Background technique [0002] Recombinase Polymerase Amplification (RPA) is known as a nucleic acid detection technology that can replace PCR. It was originally patented by ASM scientific, Inc. in 2003 (EP1499738B1). Such amplification reactions are also known as recombinase-aid amplification (RAA), Multienzyme Isothermal Rapid Amplification (MIRA) and body temperature amplification (STAMP). The basic principle is that the recombinase and the primer form a composite (filament), invade into the substrate nucleic acid template strand, open the double strand, and bind to the complementary part of the primer; Complementary strand synthesis begins at the 3' end. The single st...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6844
CPCC12Q1/6844C12Q2521/507C12Q2522/101C12Q2531/119C12Q2549/119C12Q2549/113C12Q2563/107C12Q2565/625
Inventor 白净卫刘册杜娟娟
Owner TSINGHUA UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap