Yinhong vitis vinifera phosphoenolpyruvate carboxykinase PEPCK gene as well as amplification primer and application thereof
A technology of pyruvate carboxykinase and phosphoenol, applied in the fields of application, genetic engineering, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1: The nucleotide sequence of the 鄞 鄞 磷 烯 gene, the nucleotide sequence of the coding region of the gene, as shown in SEQ ID NO.1, and the full length amino acid sequence is shown in SEQ ID NO.2.
[0030] The cloning method of nucleotide sequence SEQ ID NO.1 in the coding region of the PEPCK gene includes the following steps:
[0031] (1) Select the grape raw meat of the ripe period of the red grape, grinding with liquid nitrogen, weighing 0.1g, using a total RNA extraction kit suitable for polysaccharide polyphenol content, and extracts the total RNA extracting kit to extract the fruit total RNA, using NanoDrop2000 microacinate analysis Thermo Fisher, USA and the DYCP-31BN agarose level electrophoresis instrument, after 1.5% agarose gel electrophoresis detection RNA quality meets the requirements at -80 ° C;
[0032] (2) The full-length sequence of PEPCK genes with similar plants in Genbank is relatively similar, using ClustalW to perform multi-sequence alignment, ...
Embodiment 2
[0037] Example 2: Fluorescence Quantitative PCR Detection of PEPCK Genes in Different Mature Period of Rhodium
[0038] According to the full length of the PEPCK gene, design:
[0039] YGPEPCK-F: acctgtgagcaaactgaacc;
[0040] YGPEPCK-R: atgtTGCTTGTGCTCCTTTT;
[0041] The interference gene primers are N2-F and N2-R, respectively:
[0042] N2-f: caagagaaaccatccctagctg;
[0043] N2-R: tcaatctgtctaggaaaggaag;
[0044] The template cDNA of RT-QPCR was synthesized according to Novoscript Plus All-In-One1st Strand CDNA Synthesis Supermix (GDNAPURGE) kit (near-shore Protein Technology Co., Ltd.). Take the grape Actin (GSVIVG01000587001) for internal paramence, in-line primers N2-F and N2-R, refer to TransStart Tip Greenqpcrsupermixs Manual (Beijing Fort-Biotechnology Co., Ltd.) conducts RT-QPCR amplification, and analyzes the different mature stages of the fruit of the red grape. The expression of PEPCK genes in the fruit is to extract the total RNA of different mature periods of the red...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com