Yinhong vitis vinifera phosphoenolpyruvate carboxykinase PEPCK gene as well as amplification primer and application thereof
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of pyruvate carboxykinase and phosphoenol, applied in the fields of application, genetic engineering, plant genetic improvement, etc.
Inactive Publication Date: 2021-03-26
ZHEJIANG WANLI UNIV
View PDF1 Cites 2 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
[0004] Current studies have shown that PEPCK plays an important role in regulating the changes in sugar and acid content in the pulp of some fruits (including tomatoes, blueberries and red berries), but the research on related PEPCK genes in "Yinhong" gr
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0029] Example 1: The nucleotide sequence of the 鄞 鄞 磷 烯 gene, the nucleotide sequence of the coding region of the gene, as shown in SEQ ID NO.1, and the full length amino acid sequence is shown in SEQ ID NO.2.
[0030] The cloning method of nucleotide sequence SEQ ID NO.1 in the coding region of the PEPCK gene includes the following steps:
[0031] (1) Select the grape raw meat of the ripe period of the red grape, grinding with liquid nitrogen, weighing 0.1g, using a total RNA extraction kit suitable for polysaccharide polyphenol content, and extracts the total RNA extracting kit to extract the fruit total RNA, using NanoDrop2000 microacinate analysis Thermo Fisher, USA and the DYCP-31BN agarose level electrophoresis instrument, after 1.5% agarose gel electrophoresis detection RNA quality meets the requirements at -80 ° C;
[0032] (2) The full-length sequence of PEPCK genes with similar plants in Genbank is relatively similar, using ClustalW to perform multi-sequence alignment, ...
Embodiment 2
[0037] Example 2: Fluorescence Quantitative PCR Detection of PEPCK Genes in Different Mature Period of Rhodium
[0038] According to the full length of the PEPCK gene, design:
[0039] YGPEPCK-F: acctgtgagcaaactgaacc;
[0040] YGPEPCK-R: atgtTGCTTGTGCTCCTTTT;
[0041] The interference gene primers are N2-F and N2-R, respectively:
[0042] N2-f: caagagaaaccatccctagctg;
[0043] N2-R: tcaatctgtctaggaaaggaag;
[0044] The template cDNA of RT-QPCR was synthesized according to Novoscript Plus All-In-One1st Strand CDNA Synthesis Supermix (GDNAPURGE) kit (near-shore Protein Technology Co., Ltd.). Take the grape Actin (GSVIVG01000587001) for internal paramence, in-line primers N2-F and N2-R, refer to TransStart Tip Greenqpcrsupermixs Manual (Beijing Fort-Biotechnology Co., Ltd.) conducts RT-QPCR amplification, and analyzes the different mature stages of the fruit of the red grape. The expression of PEPCK genes in the fruit is to extract the total RNA of different mature periods of the red...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention discloses a Yinhong vitis vinifera phosphoenolpyruvate carboxykinase PEPCK gene, a primer for amplifying the Yinhong vitis vinifera phosphoenolpyruvate carboxykinase PEPCK gene, a primerfor fluorescent quantitative RT-qPCR of the Yinhong vitis vinifera phosphoenolpyruvate carboxykinase PEPCK gene and an application of the Yinhong vitis vinifera phosphoenolpyruvate carboxykinase PEPCK gene to regulation and control of sugar acid content of Yinhong vitis vinifera fruits. SPSS software analysis shows that the expression quantity of the PEPCK gene is in extremely remarkable positivecorrelation with accumulation of glucose and fructose in the color changing period, besides, the expression quantity of the PEPCK gene is in remarkable negative correlation with the content change offruit organic acid, and it can be proved that the PEPCK gene plays a role in regulating and controlling synthesis of saccharic acid in the Yinhong vitis vinifera fruit ripening process. The inventionlays a foundation for subsequent researches on exact functions of the Yinhong vitis vinifera PEPCK gene, sugar acid metabolism regulation ways in which the Yinhong vitis vinifera PEPCK gene participates and the like.
Description
Technical field [0001] The present invention relates to the field of biotechnology, in particular a pyrocarboxygen-phosphate-type pyruvate carboxygenase PEPCK gene, its amplification primers and applications. Background technique [0002] Vitis Vinifera is an important cultivated fruit tree, its planting area and yield are in the forefront of the world. my country is the world's major grape planting countries, of which my country is mainly cultivated by fresh grapes. The economic value of fresh food is mainly reflected in quality. Since sugar acid is better than suitable grape qualities, the content and proportion of sugar and organic acid in grape fruit and the content of the grape fruit are the main factors affecting its quality. . "红" grapes are excellent fresh food species, and the fruits in the fruit are 35, and there is excellent quality in the range of sugar acid ratio. [0003] Studies that the organic acid accumulated during the maturity of fruit can be transformed into ...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more