Deep-sea fungus FS140 anti-gliotoxin self-protection gene GliM and application thereof

A gliotoxin and gene protection technology, applied in the field of genetic engineering, can solve the problems of inducing apoptosis, redox reaction imbalance, reducing immune activity, etc.

Active Publication Date: 2021-04-06
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The toxicity of gliotoxin to the host mainly includes: inducing apoptosis; causing redox reaction imbalance; inhibiting proteasome activity, leading to the inhibition of NF-κB activity, reducing immune activity, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Deep-sea fungus FS140 anti-gliotoxin self-protection gene GliM and application thereof
  • Deep-sea fungus FS140 anti-gliotoxin self-protection gene GliM and application thereof
  • Deep-sea fungus FS140 anti-gliotoxin self-protection gene GliM and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1 Obtaining the self-protection gene sequence of the deep-sea fungus Geosmithia pallida FS140 against gliotoxin

[0025]Amplification of the gene GliM: Inoculate the deep-sea fungus Geosmithia pallida FS140 on the YPD medium plate, culture at 37°C for 72 hours, pick fresh mycelium, use the fungal RNA extraction kit to extract RNA, and then use the All-in-one RTMaster cDNA was obtained by reverse transcription with Kit. According to the transcriptome sequencing results, the anti-trichothecene self-protection gene GliM sequence was predicted, and specific primers were designed upstream and downstream of it. The primer sequence was GliM-F:5'-ATGGAAGCCAACAACACCGAC-3'; GliM-R:5' -CTACTTCTTCAGCCGTAATTCCAA-3', using the cDNA library as template amplification to obtain PCR product ( figure 1 ). The product was recovered and cloned by TA with pEASY-T1 kit, transformed into Escherichia coli competent cells, spread on the ampicillin resistance plate to screen out positi...

Embodiment 2

[0026] Example 2 Functional verification of anti-gliotoxin self-protection gene GliM

[0027] The gene GliM was inserted into the yeast vector YEp352-TEF1-CYC1 by homologous recombination (YEp352-TEF1-CYC1 is an early constructed plasmid, carrying a constitutive promoter TEF1 and a terminator CYC1, see the vector map image 3 A, known products in the prior art: Xiaodan Ouyang, Yaping Cha, Wen Li, Chaoyi Zhu, Muzi Zhu, ShuangLi, Min Zhuo, Shaobin Huang and Jianjun Li. Stepwise engineering of Saccharomyces cerevisiae to produce(+)-valencene and its related sequiterpenes, RSC Adv., 2019, 9, 30171, DOI: 10.1039 / c9ra05558d). First design the upstream and downstream primers YEp352-GliM-F and YEp352-GliM-R for the amplification of gene GliM (SEQ ID NO.1), the primer sequence of which is YEp352-GliM-F:5'- ATAGCAATCTAATCTAAGTCTAGA ATGGAAGCCAACAACACCGAC-3'; YEp352-GliM-R:5'- TACATGATGCGGCCCGTCGAC CTACTTCTTCAGCCGTAATTCCAA-3' (the underlined sequence is the homology arm fragment), the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a deep-sea fungus FS140 anti-gliotoxin self-protection gene GliM and an application of the deep-sea fungus FS140 anti-gliotoxin self-protection gene GliM. The nucleotide sequence of the anti-gliotoxin self-protection gene GliM is as shown in SEQ ID NO.1. Therefore, an anti-gliotoxin self-protection gene GliM sequence is obtained from a cDNA library of deep sea fungi FS140 and is successfully introduced into saccharomyces cerevisiae S.cerevisiae BJ5464 for anti-toxic function verification, so that the anti-gliotoxin capability of the saccharomyces cerevisiae is improved in the later period, and the anti-gliotoxin capability of the saccharomyces cerevisiae is improved. The heterologous expression level of the gliotoxin is improved, and a molecular biological foundation is laid for obtaining the novel gliotoxin.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a gliotoxin-resistant self-protection gene GliM of deep-sea fungus Geosmithia pallida FS140 and an application thereof. Background technique [0002] In the early stage, our research group isolated more than 20 gliotoxin compounds from the deep-sea fungus Geosmithia pallida FS140, including gliotoxin dimer compounds with rare structures, most of which have obvious antitumor activity . [0003] Gliotoxin (GT) is a kind of diketopiperazine (epipolythiodioxopiperazine, ETP), ETP as an important virulence factor, it produces specific toxicity to various cells through different pathways, in invasive aspergillosis play an important role in synergy. The toxic and side effects of ETP are mainly through the cross-linking of disulfide bonds and sulfhydryl groups with the target protein to inactivate the protein activity, and can generate toxic reactive oxygen species (react...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N15/81C12N1/19C12R1/865
CPCC12N9/1007C12N15/81
Inventor李赛妮章卫民
OwnerGUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY