Deep-sea fungus FS140 anti-gliotoxin self-protection gene GliM and application thereof
A gliotoxin and gene protection technology, applied in the field of genetic engineering, can solve the problems of inducing apoptosis, redox reaction imbalance, reducing immune activity, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 Obtaining the self-protection gene sequence of the deep-sea fungus Geosmithia pallida FS140 against gliotoxin
[0025]Amplification of the gene GliM: Inoculate the deep-sea fungus Geosmithia pallida FS140 on the YPD medium plate, culture at 37°C for 72 hours, pick fresh mycelium, use the fungal RNA extraction kit to extract RNA, and then use the All-in-one RTMaster cDNA was obtained by reverse transcription with Kit. According to the transcriptome sequencing results, the anti-trichothecene self-protection gene GliM sequence was predicted, and specific primers were designed upstream and downstream of it. The primer sequence was GliM-F:5'-ATGGAAGCCAACAACACCGAC-3'; GliM-R:5' -CTACTTCTTCAGCCGTAATTCCAA-3', using the cDNA library as template amplification to obtain PCR product ( figure 1 ). The product was recovered and cloned by TA with pEASY-T1 kit, transformed into Escherichia coli competent cells, spread on the ampicillin resistance plate to screen out positi...
Embodiment 2
[0026] Example 2 Functional verification of anti-gliotoxin self-protection gene GliM
[0027] The gene GliM was inserted into the yeast vector YEp352-TEF1-CYC1 by homologous recombination (YEp352-TEF1-CYC1 is an early constructed plasmid, carrying a constitutive promoter TEF1 and a terminator CYC1, see the vector map image 3 A, known products in the prior art: Xiaodan Ouyang, Yaping Cha, Wen Li, Chaoyi Zhu, Muzi Zhu, ShuangLi, Min Zhuo, Shaobin Huang and Jianjun Li. Stepwise engineering of Saccharomyces cerevisiae to produce(+)-valencene and its related sequiterpenes, RSC Adv., 2019, 9, 30171, DOI: 10.1039 / c9ra05558d). First design the upstream and downstream primers YEp352-GliM-F and YEp352-GliM-R for the amplification of gene GliM (SEQ ID NO.1), the primer sequence of which is YEp352-GliM-F:5'- ATAGCAATCTAATCTAAGTCTAGA ATGGAAGCCAACAACACCGAC-3'; YEp352-GliM-R:5'- TACATGATGCGGCCCGTCGAC CTACTTCTTCAGCCGTAATTCCAA-3' (the underlined sequence is the homology arm fragment), the...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com