A SARS-CoV-2 virus S protein receptor binding region encoding gene, antibody and application

A receptor binding, sars-cov-2 technology, applied in the field of biomedicine, to achieve the effect of ensuring uniqueness, simple operation and high sensitivity

Active Publication Date: 2022-03-11
HANGZHOU BIOLYNX TECH CO LTD
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is still a lack of effective neutralizing detection antibodies against SARS-CoV-2 S RBD in clinical practice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A SARS-CoV-2 virus S protein receptor binding region encoding gene, antibody and application
  • A SARS-CoV-2 virus S protein receptor binding region encoding gene, antibody and application
  • A SARS-CoV-2 virus S protein receptor binding region encoding gene, antibody and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1 SARS-CoV-2 S RBD coding gene optimization and expression

[0069] The amino acid sequence position of the sugar spike protein S RBD (Spike protein RBD, S RBD) of SARS-CoV-2 is aa319-aa541, as shown in UniProt-PODTC2 (SPIKE_SARS2) for details, expressing the SARS-CoV-2 spike protein S The native nucleotide sequence of RBD is as follows (SEQ ID NO: 1).

[0070] AGAGTCCAACCAACAGAATCTATTGTTAGATTTCCTAATATTACAAA CTTGTGCCCTTTTGGTGAAGTTTTTAACGCCACCAGATTTGCATCTGTTTA TGCTTGGAACAGGAAGAGAATCAGCAACTGTGTTGCTGATTATTCTGTCC TATATAATTCCGCATCATTTTCCACTTTTAAGTGTTATGGAGTGTCTCCTA CTAAATTAAATGATCTCTGCTTTACTAATGTCTATGCAGATTCATTTGTAA TTAGAGGTGATGAAGTCAGACAAATCGCTCCAGGGCAAACTGGAAAGAT TGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGC TTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCT GTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTT CAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATGGTGTTGAAGGT TTTAATTGTTACTTTCCTTTACAATCATATGGTTTCCAACCCACTAATGGT GTTGGTTACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACA...

Embodiment 2

[0077] Example 2 Expression and purification of SARS-Cov-2 S RBD recombinant protein

[0078] The C-terminus of the expressed protein of SEQ ID NO:2 is linked to the Fc fragment of human IgG1 (P01857) for purification and subsequent detection.

[0079] Synthesize the BRP2 gene fragment, connect the BRP2 gene fragment to the upper pBV vector (Bailing Bio), and transform it into Escherichia coli for 16 hours at 37°C.

[0080] The next day, the BRP2 plasmid was lysed and extracted. According to a conventional method, 50 μg of pBV-BRP2 was used to transfect 50 mL of 293-6E cells with cationic liposomes. After 6 days of transfection, the cells and supernatant were collected, and the collected cells were lysed to prepare a cell lysate. The supernatant after transfection was collected, the recombinant protein was purified using a nickel column, and the buffer was replaced with PBS. Purified samples were stored at 4°C.

Embodiment 3

[0081] Example 3 Identification of SARS-CoV-2 S RBD recombinant protein

[0082] The SARS-CoV-2 S RBD recombinant protein was identified using ELISA, SDS-PAGE, and Western blot respectively. The specific identification methods are as follows:

[0083] 1. Identification of ELISA method

[0084] 1) Coat the ACE2 recombinant protein (with His tag) receptor in the extracellular region (Cat. No.: ACE-HM401, Shanghai Kaijia Biology), dilute the ACE2 recombinant protein concentration in carbonate buffer to 2 μg / mL, 50 μL / well ELISA plate was coated overnight at 4°C.

[0085] 2) The next day, use 0.01M, pH7.4 PBST to place the coated microplate plate on a plate washer and wash the plate 3 times, 250 μL / well.

[0086] 3) Add 100 μL of 3% BSA / PBST solution to each well, block and incubate at 30°C for 1h-2h.

[0087] 4) After washing the plate, add SARS-CoV-2 S RBD recombinant protein ligand starting from 4 μg / mL and 4-fold dilution to each well, 50 μL / well. Incubate at 30°C for abou...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a recombinant protein expressed by a gene encoded by the receptor binding region of the S protein of SARS‑CoV‑2 virus, an antibody produced by the recombinant protein and its application, belonging to the fields of biomedicine and immunological detection. The coding gene has the nucleotide sequence shown in SEQ ID NO:2. The coding gene or antibody can be applied to prepare and detect antibodies against the S protein receptor binding region of SARS-CoV-2 virus. The invention discloses an antibody prepared by utilizing the recombinant protein expressed by the coding gene and its application. The encoding gene of the invention ensures the uniqueness of protein expression and reduces the difficulty of subsequent protein purification. The prepared antibody has high sensitivity and strong specificity for detecting antigen.

Description

technical field [0001] The invention belongs to the fields of biomedicine and immunological detection, and in particular relates to a gene encoding the receptor binding region of the S protein of SARS-CoV-2 virus, an antibody and its application. Background technique [0002] After the new coronavirus vaccine is successfully developed and vaccinated in humans, it is particularly important to effectively identify the new coronavirus and prevent the antiserum detection of the new coronavirus infection. Among them, only antibodies with neutralizing activity can prevent the new coronavirus from interacting with human angiotensin converting enzyme. 2 (angiotensin-converting enzyme 2, ACE2) combination. At present, there are many methods for this type of detection, such as ELISA, kits, and test strips. Immunochromatography test strips are the fastest and most convenient of all tests, and have high specificity and sensitivity without special equipment. And professional technicians...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/50C07K14/165C07K19/00C07K16/10C12N15/85G01N33/68G01N33/569G01N33/577A61K39/42A61P31/14
CPCC07K14/005C07K16/10C12N15/85G01N33/6854G01N33/56983G01N33/577A61P31/14C12N2770/20022C07K2319/30C07K2317/565C07K2317/76C12N2800/107G01N2333/165G01N2469/20G01N2469/10
Inventor潘丽李明振蔡宁
OwnerHANGZHOU BIOLYNX TECH CO LTD