Method for improving tolerance and use ratio of microorganisms for methyl alcohol

A technology of tolerance and utilization rate, applied in the application field of bioconversion methanol, can solve the problems of toxicity and so on

Active Publication Date: 2021-04-20
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, methanol, as an organic solvent, has certain toxicity to microbial cells, s...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving tolerance and use ratio of microorganisms for methyl alcohol
  • Method for improving tolerance and use ratio of microorganisms for methyl alcohol
  • Method for improving tolerance and use ratio of microorganisms for methyl alcohol

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0082] Embodiment 1. Introducing cgl0833 gene missense mutation in Corynebacterium glutamicum MX-11

[0083]Strain C.glutamicum MX-11 was obtained from literature (Tuyishima, P., Wang, Y., Fan, L., Zhang, Q., Li, Q., Zheng, P., Sun, J., Ma, Y., 2018. Engineering Corynebacterium glutamicum formethanol-dependent growth and glutamate production. Metab. Eng. 49, 220-231).

[0084] (1) Construction of pK18mobsacB-tet-cgl0833 C1439T plasmid

[0085] a. Linearize pK18mobsacB-tet empty vector using BamHI endonuclease.

[0086] b. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, use single-stranded nucleotide cgl0833-F1 (TATGACATGATTACGAATTCTACTTGATCGCTCAGATGGCTGG; SEQ ID NO: 1) and cgl0833-R1 (CTGCTGGGGACAGGAAGATCAGCAGCAGC; SEQ ID NO: 2) as primers to amplify The upper half fragment of cgl0833, while introducing a mutation from C to T at the 1439th base of cgl0833.

[0087] c. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nu...

Embodiment 2

[0096] Example 2. Methanol biotransformation

[0097] (1) culture medium

[0098]In glucose-free CGXII medium, methanol and xylose were added as carbon sources, and 1 mM isopropylthiogalactopyranoside (IPTG), 5 mg / L chloramphenicol and 25 mg / L kanamycin were additionally added. CGXII medium formula refers to literature (Keilhauer, C., Eggeling, L., Sahm, H., 1993. Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvCoperon. J. Bacteriol. 175, 5595-5603).

[0099] (2) Culture conditions

[0100] C. glutamicum strains MX-11 and MX-11-cgl0833 C1439T They were inoculated in shake flasks containing the above-mentioned medium, and the initial OD600 nm was about 0.5 (the initial dry cell weight was about 0.153 gCDW / L). The shaker flask was cultured in a shaker at a temperature of 30°C and a rotation speed of 220rpm. The size of the shaker flask was 250mL, and the liquid volume was 50mL. The shaker flask was sealed with an airtight sealing fil...

Embodiment 3

[0108] Example 3. Construction of a mutant strain of Corynebacterium glutamicum ATCC13032 expressed in fusion with cgl0833 and green fluorescent protein egfp

[0109] (1) Construction of pK18mobsacB-cgl0833-egfp plasmid

[0110] a. Linearize pK18mobsacB empty vector using BamHI endonuclease.

[0111] b. With pTRCmob-egfp plasmid (Wang, Y., Cao, G., Xu, D., Fan, L., Wu, X., Ni, X., Zhao, S., Zheng, P., Sun, J., Ma, Y., 2018. A novel Corynebacterium glutamicum L-glutamate exporter. Applied and environmental microbiology 84, e02691-17.) as a template, using single-stranded nucleotide egfp-F (GTGAGCAAGGGCGAGGAGC; SEQ ID NO: 7) and egfp-R (TTACTTGTACAGCTCGTCCATGC; SEQ ID NO: 8) were used as primers to amplify the egfp gene fragment.

[0112] c. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotides cgl0833-F3 (GAGCTCGGTACCCGGGGATCCATTATGACCGTTCTGACCTTCGT; SEQ ID NO: 9) and cgl0833-R3 (AGCTCCTCGCCCTTGCTCACGTGATCAACAGCCTTTTCAACA; SEQ ID N...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for constructing a bacterial strain of which the methyl alcohol tolerance is improved through weakening expression of a cgl0833 gene in the bacterial strain. The invention also discloses a constructed methyl alcohol biotransformation bacterial strain of which the methyl alcohol tolerance is improved, and a method for carrying out methyl alcohol biotransformation by the bacterial strain. While the bacterial strain constructed by the invention utilizes a mixed carbon source formed by the methyl alcohol and other auxiliary carbon sources, the use ratio of the methyl alcohol is obviously improved, and therefore, the use efficiency of the bacterial strain for the methyl alcohol is substantially improved.

Description

technical field [0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to a method for improving the tolerance and utilization rate of bacterial strains to methanol, the bacterial strain obtained by the method, and the application of the method and the obtained bacterial strain in bioconversion of methanol. Background technique [0002] Methanol is the primary platform product of coal chemical industry, shale gas chemical industry and industrial and agricultural waste gasification. my country's methanol production capacity has reached 80 million tons per year, accounting for more than 50% of the international total, showing a trend of excess. The development of methanol economy urgently needs supporting facilities The methanol conversion and utilization technology [Chen Jijun, Chen Guangda, 2016; Zhang Shixin et al., 2013]. Biotransformation has the characteristics of diverse products, high product selectivity and gree...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/21C12N15/31C07K14/34C12R1/15
Inventor 孙际宾王钰郑平凡立稳周文娟马延和
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap