Method for improving tolerance and use ratio of microorganisms for methyl alcohol
A technology of tolerance and utilization rate, applied in the application field of bioconversion methanol, can solve the problems of toxicity and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0082] Embodiment 1. Introducing cgl0833 gene missense mutation in Corynebacterium glutamicum MX-11
[0083]Strain C.glutamicum MX-11 was obtained from literature (Tuyishima, P., Wang, Y., Fan, L., Zhang, Q., Li, Q., Zheng, P., Sun, J., Ma, Y., 2018. Engineering Corynebacterium glutamicum formethanol-dependent growth and glutamate production. Metab. Eng. 49, 220-231).
[0084] (1) Construction of pK18mobsacB-tet-cgl0833 C1439T plasmid
[0085] a. Linearize pK18mobsacB-tet empty vector using BamHI endonuclease.
[0086] b. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, use single-stranded nucleotide cgl0833-F1 (TATGACATGATTACGAATTCTACTTGATCGCTCAGATGGCTGG; SEQ ID NO: 1) and cgl0833-R1 (CTGCTGGGGACAGGAAGATCAGCAGCAGC; SEQ ID NO: 2) as primers to amplify The upper half fragment of cgl0833, while introducing a mutation from C to T at the 1439th base of cgl0833.
[0087] c. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nu...
Embodiment 2
[0096] Example 2. Methanol biotransformation
[0097] (1) culture medium
[0098]In glucose-free CGXII medium, methanol and xylose were added as carbon sources, and 1 mM isopropylthiogalactopyranoside (IPTG), 5 mg / L chloramphenicol and 25 mg / L kanamycin were additionally added. CGXII medium formula refers to literature (Keilhauer, C., Eggeling, L., Sahm, H., 1993. Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvCoperon. J. Bacteriol. 175, 5595-5603).
[0099] (2) Culture conditions
[0100] C. glutamicum strains MX-11 and MX-11-cgl0833 C1439T They were inoculated in shake flasks containing the above-mentioned medium, and the initial OD600 nm was about 0.5 (the initial dry cell weight was about 0.153 gCDW / L). The shaker flask was cultured in a shaker at a temperature of 30°C and a rotation speed of 220rpm. The size of the shaker flask was 250mL, and the liquid volume was 50mL. The shaker flask was sealed with an airtight sealing fil...
Embodiment 3
[0108] Example 3. Construction of a mutant strain of Corynebacterium glutamicum ATCC13032 expressed in fusion with cgl0833 and green fluorescent protein egfp
[0109] (1) Construction of pK18mobsacB-cgl0833-egfp plasmid
[0110] a. Linearize pK18mobsacB empty vector using BamHI endonuclease.
[0111] b. With pTRCmob-egfp plasmid (Wang, Y., Cao, G., Xu, D., Fan, L., Wu, X., Ni, X., Zhao, S., Zheng, P., Sun, J., Ma, Y., 2018. A novel Corynebacterium glutamicum L-glutamate exporter. Applied and environmental microbiology 84, e02691-17.) as a template, using single-stranded nucleotide egfp-F (GTGAGCAAGGGCGAGGAGC; SEQ ID NO: 7) and egfp-R (TTACTTGTACAGCTCGTCCATGC; SEQ ID NO: 8) were used as primers to amplify the egfp gene fragment.
[0112] c. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotides cgl0833-F3 (GAGCTCGGTACCCGGGGATCCATTATGACCGTTCTGACCTTCGT; SEQ ID NO: 9) and cgl0833-R3 (AGCTCCTCGCCCTTGCTCACGTGATCAACAGCCTTTTCAACA; SEQ ID N...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



