B-type response regulator gene brrr10 in Chinese cabbage and its application

A regulator, cabbage technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problem of limited function of B-type response regulator

Active Publication Date: 2022-07-01
ZHEJIANG UNIV +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, TCS-related genes similar to Arabidopsis have been found in many plants, but the function of B-type response regulators in Chinese cabbage is very limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • B-type response regulator gene brrr10 in Chinese cabbage and its application
  • B-type response regulator gene brrr10 in Chinese cabbage and its application
  • B-type response regulator gene brrr10 in Chinese cabbage and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] Example 1: Construction of cabbage BrRR10 subcellular localization vector

[0022] 1. Total RNA extraction from plant inflorescence

[0023] Total RNA was extracted from the inflorescence tissue samples of Chinese cabbage 'Chiifu-401-42' using the Omega Plant RNA Kit. The specific steps were as follows: about 100 mg of the sample was ground in liquid nitrogen, transferred to a 1.5 ml centrifuge tube, and 500 μL of RBBuffer (already added β-mercaptoethanol), vortex vigorously; centrifuge at 14,000 rpm for 5 min, take the supernatant and transfer it to the gDNA Filter Column, and centrifuge at 14,000 rpm for 2 min; add 0.5 times the volume of absolute ethanol to the filtrate, invert and mix; the mixed solution is transferred to the HiBind RNA mini column , centrifuge at 10,000 rpm for 1 min, discard the filtrate; add 400 μl of RWF Wash Buffer, centrifuge at 10,000 rpm for 1 min, discard the filtrate; add 500 μL RNAWash Buffer II, centrifuge at 10,000 rpm for 1 min, discar...

Embodiment 2

[0038] Example 2: Construction of cabbage BrRR10 heterologous expression vector

[0039] Take cabbage flower cDNA as template amplification gene fragment and adopt gel recovery fragment (primers are shown in Table 2), utilize homologous recombination method to link into the pAC007-3*FLAG carrier double digested by Kpn I and Bam H I, transform Escherichia coli After the competent DH5α was verified by bacterial liquid PCR and sequenced to prove that the gene fragment and connection were correct, the vector plasmid was extracted and stored at -20°C for later use. See Example 1 for specific steps.

[0040] Table 2 Primers used in the construction of heterologous expression vectors

[0041] primer name Primer sequence (5'-3') BrRR10-F GGGCGCGCCGGTACCATGACATTGGAACAAGATT (SEQ ID No. 4) BrRR10-R ATAGTCCATGGATCCTATGCATGTTCTGAGTGAGCTA (SEQ ID No. 5)

[0042] The heterologous expression vector plasmids that have been verified and compared successfully were ...

Embodiment 3

[0045] Example 3: Arabidopsis thaliana transformed by flower soaking and screening of positive transformants

[0046] 1. Transformation of Arabidopsis thaliana by soaking method

[0047] Take 100 μL of the activated plasmid containing the heterologous expression vector ( figure 2 A) and pAC007-3*FLAG empty-loaded plasmid Agrobacterium bacteria were added to 30 mL of liquid LB medium containing 50 mg / ml Rif, Str, and Cmr, respectively, and shaken at 28°C overnight. When the bacterial liquid was cultured to an OD600 of about 1.0, centrifuge at 8000rpm for 10min, discard the supernatant, resuspend with an equal volume of resuspension (5wt% sucrose, 200μL / L Silwet L-77), and stir well for 2min. The wild-type Arabidopsis thaliana was removed from siliques and open flowers, the inflorescence was immersed in the bacterial solution for about 30s, the excess bacterial solution was taken out and dried with absorbent paper, and after culturing in the dark for 24h, it was placed in an i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides cabbage type B response regulator gene BrRR10 and application thereof, and belongs to the technical field of plant genetic engineering. The DNA sequence of the cabbage type B response regulator gene BrRR10 is shown in SEQ ID No.1. The gene was transformed into Arabidopsis thaliana by Agrobacterium dipping transformation method to obtain an Arabidopsis line with heterologous expression of BrRR10. It was found that the heterologous expression of the cabbage type B response regulator gene BrRR10 would lead to Arabidopsis thaliana. The number of leaves increased, the leaves became smaller, the number of branches increased significantly, and the root length of the primary root was significantly shortened. This indicated that the B-type response regulator gene BrRR10 in Chinese cabbage plays an important regulatory role in leaf development, branch number regulation and primary root development.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, in particular to the B-type response regulator gene BrRR10 of cabbage, its encoded protein and its application in the process of plant breeding. Background technique [0002] Cabbage (Brassica rapa L.syn.B.campestris L.) belongs to the Brassica Brassica species of the cruciferous family. It is rich in nutrients and has strong resistance to low temperature, and has extremely high economic value in production. Among them, head cabbage and pak choi are the vegetable crops with the largest cultivation area and consumption in my country. And it is closely related to the model plant Arabidopsis thaliana, which is also a cruciferous family, and also has important research significance in plant basic science. Different crops have different organs, and can be divided into root vegetables, stem vegetables, leafy vegetables, cauliflower and fruit vegetables according to their edible parts...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/29C12N15/82A01H5/00A01H5/06A01H5/12A01H6/20
CPCC07K14/415C12N15/8261
Inventor余小林周芳园孔李俊赵彤宋建伟
OwnerZHEJIANG UNIV