TGF-beta3 mesenchymal stem cell exosome and preparation method and application thereof
A TGF-, stem cell technology, applied in the field of biomedicine, can solve the problems of increased expression of incapable cytokines, low content, poor targeting, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] The construction of embodiment 1 lentiviral vector
[0048] 1. Design the gene sequence of the fusion protein TGF-β3. According to specific needs, the fusion protein we designed includes the N-terminal signal peptide, the target gene TGF-β3, the junction region and the transmembrane region. The structure of the N-terminal signal peptide and the transmembrane region adopts the corresponding structure of the surface marker CD44 of mesenchymal stem cells. The connecting region is a flexible chain of 8 amino acids, and the sequences of each part are as follows:
[0049] N-terminal signal peptide:
[0050] ATGGACAAGTTTTGGTGGCACGCAGCCTGGGGACTCTGCCTCGTGCCGCTGAGCCTGGCG (SEQ ID NO. 1)
[0051] Target gene TGF-β3:
[0052] ATGAAGATGCACTTGCAAAGGGCTCTGGTGGTCCTGGCCCTGCTGAACTTTGCCACGGTCAGCCTCTCTCTGTCCACTTGCACCACCTTGGACTTCGGCCACATCAAGAAGAAGAGGGTGGAAGCCATTAGGGGACAGATCTTGAGCAAGCTCAGGCTCACCAGCCCCCCTGAGCCAACGGTGATGACCCACGTCCCCTATCAGGTCCTGGCCCTTTACAACAGCACCCGGGAGCTGCTGGAGGAGATGCATGGGGAGA...
Embodiment 2
[0065] Example 2 Characterization of Mesenchymal Stem Cells Infected with TGF-β3 Virus
[0066] 1. Infect the cells with lentivirus, take 10ug of the target plasmid and add it to 950μL of 1×HBS, mix gently, and then slowly drop 50μL of CaCl into it 2 , mix gently and let stand for 20min, add to the HEK 293T cells with a density of 70%, mix gently, put in 37℃, 5%CO 2 After 12 hours, replace it with 10 mL of 30% FBS complete medium for culture. After 48 hours, take the cell supernatant, and centrifuge at 4000 rpm for 15 minutes at room temperature. Take the supernatant and add it to the mesenchymal stem cells with a cell density of 50%, add polybrene with a final concentration of 8ug / ml, mix well, and put it in 37°C, 5% CO 2 After 12 hours, replace with 10% FBS complete medium.
[0067] 2. Screen the mesenchymal stem cells that successfully express TGF-β3, add puromycin at a final concentration of 2ug / ml to the infected mesenchymal stem cells for screening, last for 2-3 days, ...
Embodiment 3
[0081] Example 3 Characterization of TGF-β3 exosomes secreted by mesenchymal stem cells infected with TGF-β3 lentivirus
[0082] 1. Extract exosomes from normal mesenchymal stem cells, mesenchymal stem cells co-incubated with TGF-β3 growth factor, and mesenchymal stem cells infected with TGF-β3 lentivirus. After the cells were cultured until the degree of confluence reached 50%, they were replaced with DMEM containing 0.5% fetal bovine serum and 1% P / S without exosomes and cultured for 48 hours. After the culture was completed, the cell culture medium was collected for gradient centrifugation and kept at 4°C throughout the process. 500×g, 10min, take the supernatant. 2000×g, 20min, take the supernatant. 10000×g, 40min, take the supernatant. The supernatant was centrifuged at 100,000×g for 90 min with an ultracentrifuge, and the precipitate was collected. After resuspending the pellet with PBS, continue to perform ultracentrifugation at 4°C, 100,000×g, 90 min, and take the ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Particle size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



