Sequence for increasing the translation initiation site of Gram-positive bacteria and its application in improving protein expression efficiency
A technology of Gram-positive bacteria and starting sites, which is applied in the fields of genetic engineering and microbial engineering, can solve the problems of insignificant improvement and achieve the effects of easy genetic modification, enhanced stability, and improved expression efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] The construction of the expression green fluorescent protein (GFP) vector applicable to the 5'-UTR single copy RBS of Bacillus licheniformis and Bacillus subtilis:
[0032] For Bacillus licheniformis and Bacillus subtilis, the gene expression vector is designed based on pHY300PLK:
[0033] 1. According to the Bacillus subtilis (B.subtilis) 168 genome sequence NZ_CP010052.1 released by the NCBI database, find the original sequence of P43, use the Primer Primer 5 software to design primers P43-F and P43-R, and use the total DNA of B.subtilis 168 as The original promoter P43 was amplified from the template, and its 5'-UTR original sequence was GTGATAGCGGTACCATTATAGGTAAGAGAGGAATGTACAC; the primers were designed as follows:
[0034] P43-F: GCGGAATTTCCAATTTCA
[0035] P43-R: GTGTACATTCCTCTCTTACCTATAA
[0036]2. Using the promoter P43 amplified in step 1 as a template, use Primer Primer5 software to design primers P43-F and P43-repeat-R, and change the 5'-UTR region of the P...
Embodiment 2
[0057] Construction of expression green fluorescent protein (GFP) vectors suitable for Bacillus licheniformis and Bacillus subtilis:
[0058] The multi-copy RBS expression vector is designed with A1-repeat1-GFP:
[0059] 1. Using A1-repeat1-GFP as a template, design primers at the 5'-UTR position. The forward primer GFP-repeat-F contains the 18nt bases at the end of the 5'-UTR of the single-copy plasmid and the 18nt bases at the 5'-end of the GFP gene, and the reverse primer GFP-repeat-R is the reverse primer of two copies of the 5'-UTR. to the sequence;
[0060] Primers were designed as follows:
[0061] GFP-repeat-F: AGAAAGGAGGAAGGATCAATGGTCAGCAAAGGCGAA
[0062] GFP-repeat-R: TGATCCTTCCTCCTTTCTAGATCTGCTCACTGATCCTTCCTCCTTTTCT
[0063] 2. Carry out PCR reaction on the single-copy plasmid A1-repeat1-GFP through the designed primers. The principle of multi-copy amplification is because the GFP-repeat-R primer is a double-copy primer that can bridge from head to tail and cont...
Embodiment 3
[0072] The construction of the expression green fluorescent protein (GFP) vector applicable to the 5'-UTR single copy RBS of Corynebacterium glutamicum 13032:
[0073] For Corynebacterium glutamicum 13032, the gene expression vector was designed based on the commercial vector pEC-XK99E: 1. Using the promoter P of the pEC-XK99E vector trc (excluding the UTR sequence region) and the terminator rrnB T1terminator region are used as the promoter and terminator sequence of this implementation, and the primer pEC-T5-F / R is designed to linearize the vector pEC-XK99E by PCR, and the PCR product is recovered and purified;
[0074] Primers were designed as follows:
[0075] pEC-T5-F:ACACATTATACGAGCCGGAT
[0076] pEC-T5-R: CTGCAGGTCGACTCTAGATTATTTACAGTTCATCCA
[0077] 2. Design the amplification primers for the reporter protein green fluorescent protein (GFP), use the Primer Primer 5 software to design primers GFP-F and GFP-R, and amplify the 5'-UTR single copy RBS green derived from A1...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap