Sequence for increasing the translation initiation site of Gram-positive bacteria and its application in improving protein expression efficiency

A technology of Gram-positive bacteria and starting sites, which is applied in the fields of genetic engineering and microbial engineering, can solve the problems of insignificant improvement and achieve the effects of easy genetic modification, enhanced stability, and improved expression efficiency

Active Publication Date: 2022-03-18
HUBEI UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Before providing the technical solution of the present invention, the applicant attempted to concatenate multiple copies of the single-copy sequences provided in the above two public documents, and found that the concatenated sequences could further increase the expression of the protein, but the increase was not significant

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sequence for increasing the translation initiation site of Gram-positive bacteria and its application in improving protein expression efficiency
  • Sequence for increasing the translation initiation site of Gram-positive bacteria and its application in improving protein expression efficiency
  • Sequence for increasing the translation initiation site of Gram-positive bacteria and its application in improving protein expression efficiency

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] The construction of the expression green fluorescent protein (GFP) vector applicable to the 5'-UTR single copy RBS of Bacillus licheniformis and Bacillus subtilis:

[0032] For Bacillus licheniformis and Bacillus subtilis, the gene expression vector is designed based on pHY300PLK:

[0033] 1. According to the Bacillus subtilis (B.subtilis) 168 genome sequence NZ_CP010052.1 released by the NCBI database, find the original sequence of P43, use the Primer Primer 5 software to design primers P43-F and P43-R, and use the total DNA of B.subtilis 168 as The original promoter P43 was amplified from the template, and its 5'-UTR original sequence was GTGATAGCGGTACCATTATAGGTAAGAGAGGAATGTACAC; the primers were designed as follows:

[0034] P43-F: GCGGAATTTCCAATTTCA

[0035] P43-R: GTGTACATTCCTCTCTTACCTATAA

[0036]2. Using the promoter P43 amplified in step 1 as a template, use Primer Primer5 software to design primers P43-F and P43-repeat-R, and change the 5'-UTR region of the P...

Embodiment 2

[0057] Construction of expression green fluorescent protein (GFP) vectors suitable for Bacillus licheniformis and Bacillus subtilis:

[0058] The multi-copy RBS expression vector is designed with A1-repeat1-GFP:

[0059] 1. Using A1-repeat1-GFP as a template, design primers at the 5'-UTR position. The forward primer GFP-repeat-F contains the 18nt bases at the end of the 5'-UTR of the single-copy plasmid and the 18nt bases at the 5'-end of the GFP gene, and the reverse primer GFP-repeat-R is the reverse primer of two copies of the 5'-UTR. to the sequence;

[0060] Primers were designed as follows:

[0061] GFP-repeat-F: AGAAAGGAGGAAGGATCAATGGTCAGCAAAGGCGAA

[0062] GFP-repeat-R: TGATCCTTCCTCCTTTCTAGATCTGCTCACTGATCCTTCCTCCTTTTCT

[0063] 2. Carry out PCR reaction on the single-copy plasmid A1-repeat1-GFP through the designed primers. The principle of multi-copy amplification is because the GFP-repeat-R primer is a double-copy primer that can bridge from head to tail and cont...

Embodiment 3

[0072] The construction of the expression green fluorescent protein (GFP) vector applicable to the 5'-UTR single copy RBS of Corynebacterium glutamicum 13032:

[0073] For Corynebacterium glutamicum 13032, the gene expression vector was designed based on the commercial vector pEC-XK99E: 1. Using the promoter P of the pEC-XK99E vector trc (excluding the UTR sequence region) and the terminator rrnB T1terminator region are used as the promoter and terminator sequence of this implementation, and the primer pEC-T5-F / R is designed to linearize the vector pEC-XK99E by PCR, and the PCR product is recovered and purified;

[0074] Primers were designed as follows:

[0075] pEC-T5-F:ACACATTATACGAGCCGGAT

[0076] pEC-T5-R: CTGCAGGTCGACTCTAGATTATTTACAGTTCATCCA

[0077] 2. Design the amplification primers for the reporter protein green fluorescent protein (GFP), use the Primer Primer 5 software to design primers GFP-F and GFP-R, and amplify the 5'-UTR single copy RBS green derived from A1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genetic engineering and microbial engineering, and discloses a sequence for increasing the translation initiation site of Gram-positive bacteria and its application in improving protein expression efficiency. The sequence is represented by SEQ ID NO.1 Show. The invention promotes the translation of the target gene from multiple translation start sites by transforming the 5' untranslated region of the promoter. In Bacillus licheniformis and Bacillus subtilis, the expression of green fluorescent protein increased by about 150 times and 126 times compared with the original promoter P43 promoter, respectively. In Corynebacterium glutamicum, the expression of green fluorescent protein was increased by 36 times compared with the original promoter. At the same time, the mRNA leader sequence also significantly increases the expression level of keratinase in Bacillus licheniformis, which proves the universality of the sequence for improving the protein expression efficiency of Gram-positive bacteria.

Description

technical field [0001] The invention relates to the technical fields of genetic engineering and microbial engineering, in particular to the sequence used to increase the translation initiation site of Gram-positive bacteria and its application in improving protein expression efficiency. Background technique [0002] Bacillus licheniformis, Bacillus subtilis and Corynebacterium glutamicum are generally recognized as safe (GRAS) Gram-positive bacteria. They are extremely important industrial microbial production strains due to their biosafety, ability to produce a variety of valuable metabolites, and ease of genetic modification. At present, researchers have taken a series of optimization measures for each stage of protein expression of these strains to improve the expression efficiency of heterologous proteins, including promoter optimization, signal peptide screening, protease knockout, etc. [0003] The 5' untranslated region (5'-UTR) of prokaryotic mRNA usually contains r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/75C12N15/77C12N15/67
CPCC07K14/32C12N15/75C12N15/77C12N15/67
Inventor王勤陈守文张曼玉蔡东波肖军宋静
OwnerHUBEI UNIV