Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Construction method and application of CHO cell strain capable of efficiently expressing foreign proteins

A technology for high-efficiency expression of exogenous proteins, which is applied in the field of cells modified by the introduction of foreign genetic material and their construction, which can solve the problems of cumbersome procedures and unsuitable for high-efficiency expression of exogenous proteins.

Active Publication Date: 2021-07-20
PU LIKE BIO ENG
View PDF13 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, how to improve the expression of exogenous proteins expressed by the CHO expression system has always been the direction of research by scholars at home and abroad. Most of them are specifically modified for specific exogenous genes to increase the expression of exogenous proteins, which is not suitable for other exogenous proteins. High-efficiency expression, when applied to other foreign proteins, the genes of other foreign proteins need to be re-engineered, and the procedure is cumbersome

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of CHO cell strain capable of efficiently expressing foreign proteins
  • Construction method and application of CHO cell strain capable of efficiently expressing foreign proteins
  • Construction method and application of CHO cell strain capable of efficiently expressing foreign proteins

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1 The construction method of the CHO cell strain that highly expresses African swine fever virus CD2v protein

[0031] 1. Synthesis of CD2v protein gene sequence

[0032] The CD2v protein gene shown in SEQ ID.No.17 was sequence-synthesized, and the signal peptide sequence shown in SEQID.No.1 was added to the N-terminal of the CD2v sequence.

[0033] 2. Construction of expression vector for CD2v fusion Fc

[0034] Design primers to connect CD2v with the signal peptide sequence shown in SEQ ID.No.1 and the Fc gene shown in SEQ ID.No.15 by fusion, first pass primer SF1(5'GCTCTAGAGCCACCATGGACTGGACCTGGAGGATCC3') / SR1(5' GTAGGTCCCCCTTGGCTCGTACAGTTTGAAGAAAG3') to amplify the CD2v gene, and then amplify the Fc with the primer SF2 (5'CTTTCTTCAAACTGTACGAGCCAAGGGGACCTAC3') / SR2 (5'GCAAGCTTTTACTTGCCGGGTGTCCTAGAAAAGG3'), then use the previous two rounds of PCR products as templates, and use the primers SF1 / SR2 to carry out the fusion product CD2v- Amplification of mFc. T...

Embodiment 2

[0043] The preparation of embodiment 2 African swine fever virus CD2v protein

[0044] The CHO cell strain constructed and screened in Example 1 was inoculated into a bioreactor containing Dynamis medium, and the inoculation density was 3×10 5 live cells / ml. The parameters are set to pH 7.1-7.2, dissolved oxygen 40%, temperature 37°C, stirring speed 130rpm. Samples were taken every day from the third day to detect the concentrations of glucose and lactic acid, and to count the cells. When the glucose level is below 2g / L, feed glucose to 6g / L.

[0045] At the same time, 1×CD Efficient C+AGT additive was added on the 3rd day, 5th day, 7th day, and 10th day after inoculation, and the amount added each time was 10% of the volume of the culture solution. When the cell viability drops to about 80%, the cell culture is harvested, and the supernatant obtained by centrifugation is subjected to Western Blot to confirm that the target protein African swine fever virus CD2v protein is ...

Embodiment 3

[0046] The preparation of embodiment 3 porcine pseudorabies virus gD protein subunit vaccine

[0047] Referring to the method in Example 1, a CHO cell line that highly expresses the gD protein of porcine pseudorabies virus was constructed. The gene sequence of the gD protein of porcine pseudorabies virus is shown in SEQ.ID NO 18. Wherein the signal peptide sequence shown in SEQ ID.No.2 is added at the N-terminal of the gD sequence; design primers to add the signal peptide sequence shown in SEQ ID.No.2 and the Fc gene shown in SEQ ID.No.15 by fusion connected.

[0048] The constructed and screened CHO cell lines were inoculated into bioreactors containing Dynamis medium at a seeding density of 3×10 5 live cells / ml. The parameters are set to pH 7.1-7.2, dissolved oxygen 40%, temperature 37°C, stirring speed 130rpm. Samples were taken every day from the third day to detect the concentrations of glucose and lactic acid, and to count the cells. When the glucose level is below 2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a construction method and application of CHO (Chinese Hamster Ovary) cells for efficiently expressing foreign proteins, and the method comprises the following steps: (1) adding a signal peptide sequence at the N end of a foreign protein sequence; (2) connecting the foreign protein added with the signal peptide sequence with Fc through fusion to construct an expression plasmid; (3) transfecting CHO cells with the expression plasmid constructed in the step (2); and (4) harvesting the foreign protein. The invention also relates to a method for expressing a foreign protein by using the constructed CHO cell, and a vaccine composition comprising the foreign protein.

Description

technical field [0001] The invention belongs to the field of cell lines and preparation methods thereof, and in particular relates to cells modified by introducing foreign genetic material and its construction method and application. Background technique [0002] CHO cells are isolated from adult female hamster ovaries and are epithelial adherent cells. The cells are immortal and can be passed on for more than a hundred generations, and are currently widely used in bioengineering. Compared with other expression systems, it has the following advantages: (1) It has accurate post-transcriptional modification function, and the expressed protein is closest to eukaryotic natural protein in terms of molecular structure, physical and chemical properties and biological functions; (2) It can grow on the wall, and can be cultured in suspension, and can withstand high shear force and osmotic pressure; (3) has the ability to efficiently amplify and express recombinant genes; (4) has the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/62C12N5/10A61K39/245A61K39/235A61K39/12A61P31/22A61P31/20A61P31/14
CPCC12N15/85C12N5/0682C07K14/005C07K14/43559A61K39/12A61P31/22A61P31/20A61P31/14C12N2800/107C12N2510/02C07K2319/02C07K2319/30C12N2710/12022C12N2710/12051C12N2710/16722C12N2710/16751C12N2710/16734C12N2710/10222C12N2710/10251C12N2710/10234C12N2720/10022C12N2720/10051C12N2770/16022C12N2770/16051C12N2750/10022C12N2750/10051C12N2750/10034C12N2750/14322C12N2750/14351A61K2039/5256A61K2039/552
Inventor 田克恭谭菲菲张许科
Owner PU LIKE BIO ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com