Supercharge Your Innovation With Domain-Expert AI Agents!

Construction method of virus-like particle vaccines presenting peptide epitopes in different regions of RBM of SARS-COV-2

A SARS-COV-2 and construction method technology, applied in the field of virus-like particle vaccine construction, can solve problems such as inability to enhance immunogenicity, and achieve the effects of strong immunogenicity and simple preparation

Active Publication Date: 2021-07-23
INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The technical problem to be solved by the present invention is to screen 9 peptide epitopes in RBM coupled with KLH carrier for the immunogenic epitopes that cannot be enhanced by the existing conventional means in the natural S protein structure of SARS-CoV-2. Animals, the induced antibodies were subjected to in vitro neutralization experiments, and four peptide epitopes were selected to construct an effective virus-like particle vaccine presenting RBM peptide epitopes (four peptide epitopes were selected, and four peptide epitopes were constructed. Presenting peptide epitope virus-like particle vaccines), only a few vaccine injections are needed to produce strong neutralizing antibodies against the epitope, thereby achieving the purpose of preventing the infection of the new coronavirus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of virus-like particle vaccines presenting peptide epitopes in different regions of RBM of SARS-COV-2
  • Construction method of virus-like particle vaccines presenting peptide epitopes in different regions of RBM of SARS-COV-2
  • Construction method of virus-like particle vaccines presenting peptide epitopes in different regions of RBM of SARS-COV-2

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] A method for constructing a virus-like particle vaccine presenting peptide epitopes in different regions of RBM of SARS-COV-2, comprising the following steps:

[0070] Step (1), synthesizing P2, P3, P4, P6 peptide epitope genes in the RBM of SARS-COV-2;

[0071] In step (2), the hepatitis B virus core antigen HBcAg of encoding truncated is cloned into the pThioHisA vector, and then the encoding P2, P3, P4, and P6 genes obtained in step 1) are inserted into the 78-79 amino acids of hepatitis B virus core antigen HBc Ag Between, obtain recombinant plasmid pHBcAg-P2, pHBcAg-P3, pHBcAg-P4, pHBcAg-P6;

[0072] Step (3), transforming the recombinant plasmids pHBcAg-P2, pHBcAg-P3, pHBcAg-P4, pHBcAg-P6 obtained in step (2) into Escherichia coli DH5α or BL21 competent cells;

[0073] Step (4), the transformation of Escherichia coli DH5α or BL21 with recombinant plasmids pHBcAg-P2, pHBcAg-P3, pHBcAg-P4, pHBcAg-P6 with IPTG to induce the expression of step (3), was purified to ob...

Embodiment 2

[0075] A method for constructing a virus-like particle vaccine presenting peptide epitopes in different regions of RBM of SARS-COV-2, comprising the following steps:

[0076] Step (1), synthesizing P2, P3, P4, P6 peptide epitope genes in the RBM of SARS-COV-2;

[0077] In step (2), the hepatitis B virus core antigen HBcAg of encoding truncated is cloned into the pThioHisA vector, and then the encoding P2, P3, P4, and P6 genes obtained in step 1) are inserted into the 78-79 amino acids of hepatitis B virus core antigen HBc Ag Between, obtain recombinant plasmid pHBcAg-P2, pHBcAg-P3, pHBcAg-P4, pHBcAg-P6;

[0078] Step (3), transforming the recombinant plasmids pHBcAg-P2, pHBcAg-P3, pHBcAg-P4, pHBcAg-P6 obtained in step (2) into Escherichia coli DH5α or BL21 competent cells;

[0079] Step (4), the transformation of Escherichia coli DH5α or BL21 with recombinant plasmids pHBcAg-P2, pHBcAg-P3, pHBcAg-P4, pHBcAg-P6 with IPTG to induce the expression of step (3), was purified to ob...

Embodiment 3

[0101] 1) Screen target peptide epitopes P2, P3, P4, and P6 in the RBM region of the S protein; synthesize genes encoding peptide epitopes optimized by Sangon Biotech. The gene is synthesized by Sangon Bioengineering (Shanghai) Co., Ltd., as follows:

[0102] Upstream primer (5' end) encoding P2 gene: gatcttacctgtaccgtctgttccgtaaatctaacctgaagccgttcgaaggatccggtg

[0103] Downstream primer (3' end) encoding P2 gene: aattcaccggatccttcgaacggcttcaggttagattacggaacagacggtacaggtaa

[0104] Upstream primer (5' end) encoding P3 gene: gatctcgtgatatcagcaccgaaatctaccaggccggttctaccccgtgcggatccggtg

[0105] Downstream primer (3' end) encoding P3 gene: aattcaccggatccgcactatagtcgtggctttagatggtccggccaagatggggcacga

[0106] Upstream primer (5' end) encoding P4 gene: gatctaacggcgttgaaggcttcaactgctacttcccgctgcagagctacggcggatccggtg

[0107] Downstream primer (3' end) encoding P4 gene: aattcaccggatccgccgtagctctgcagcgggaagtagcagttgaagccttcaacgccgtta

[0108] Upstream primer (5' end) encoding P6 gen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for constructing virus-like particle vaccines presenting peptide epitopes in different regions of an RBM (Region Becking Model) of SARS-COV-2, which comprises the following steps: screening different peptide epitopes in the RBM of the SARS-COV-2, respectively inserting the genes between the 78th-79th amino acids of a hepatitis B virus core antigen HBcAg to obtain recombinant plasmids pHBcAg-P2, pHBcAg-P3, pHBcAg-P4 and pHBcAg-P6, transforming the plasmids into escherichia coli DH5alpha or BL21 competent cells, and using IPTG (isopropyl-beta-d-thiogalactoside) for induction and purification to obtain the virus-like particle vaccines presenting P2, P3, P4 and P6. Strong neutralizing antibodies which aim at self molecules and have a continuous effect can be induced only by immunizing and injecting the vaccines for several times, and the infection of the novel coronavirus is neutralized, which provides a new thought and lays a solid foundation for the research and development of the novel coronavirus vaccines.

Description

technical field [0001] The invention belongs to the technical fields of molecular biology and immunology, and in particular relates to a method for constructing a virus-like particle vaccine that presents peptide epitopes in different regions of RBM of SARS-COV-2. Background technique [0002] SARS-CoV-2, the causative agent of pneumonia cases that cause symptoms similar to severe acute respiratory syndrome coronavirus (SARS-CoV) infection, was declared by the World Health Organization (WHO) as a In the wake of the pandemic, there is an urgent need to understand and develop effective therapeutic interventions against SARS-CoV-2. [0003] SARS-CoV-2 is closely related to SARS-CoV, and after the SARS outbreak in 2002-2004, vaccines against SARS-Cov were developed preclinically, and two of them were tested in phase I trials. However, as the virus has been eradicated from humans and has not reemerged since 2004, development has stalled. A vaccine against MERS-CoV is currently ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/02C12N15/50C12N15/86C12N15/66A61K39/215A61P31/14
CPCC07K14/005C12N15/86C12N15/66A61K39/12A61P31/14C12N2730/10123C12N2730/10143C12N2770/20022C12N2770/20034A61K2039/5258A61K2039/5256
Inventor 马雁冰龙琼杨英黄惟巍白红妹孙文佳杨旭李多
Owner INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com