SNP molecular marker related to hypoxia resistance trait of Trachinotus ovatus and application of SNP molecular marker

A technology of oval pomfret and molecular marker, which can be applied in the directions of recombinant DNA technology, microbial determination/inspection, DNA/RNA fragment, etc., can solve the problem that the research on the marker of hypoxia tolerance trait of oval pomfret has not been reported, etc. Achieve the effect of improving genetic level and enriching resources

Active Publication Date: 2021-07-23
SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Previous studies focused on the development of SNP molecular markers such as growth traits and disease resistance traits of ovate pomfret, but there is no report on the markers of hypoxia resistance in ovate pomfret

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • SNP molecular marker related to hypoxia resistance trait of Trachinotus ovatus and application of SNP molecular marker
  • SNP molecular marker related to hypoxia resistance trait of Trachinotus ovatus and application of SNP molecular marker
  • SNP molecular marker related to hypoxia resistance trait of Trachinotus ovatus and application of SNP molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Screening of SNP markers:

[0063] (1) Randomly select 500 pompano pomfrets that have been treated with dissolved oxygen in water below the suffocation point, and record the death time of each fish as the basis for judging its hypoxia tolerance;

[0064] (2) Cut out the fin rays of 50 ovate pomfrets that died first and last, and extract DNA using the magnetic bead method DNA extraction kit, take 20 mg of fin rays, and add reagents to extract ovate pompano according to the kit instructions Trevally DNA. The extracted DNA was stored in 150 μL Buffer AE, and the DNA sample was detected by 1% agarose gel electrophoresis, and the DNA concentration and purity were detected by Nanodrop2000. The ratio of A260 / A280 was required to be between 1.8 and 2.0, and the DNA concentration was greater than 100 μg / μL.

[0065] (3) Genomic DNA was randomly broken into 350bp fragments, after end repair, phosphorylation, and A-tailing, the two ends of the fragments were respectively connecte...

Embodiment 2

[0075] Detection of SNP genotype:

[0076] The above-mentioned SNP molecular markers of the present invention were verified in another germplasm population containing 497 ovate pomfrets.

[0077] To determine the hypoxic tolerance of pomfret ovata, that is, the survival time under dissolved oxygen lower than the suffocation point. Concrete measuring method is with embodiment 1.

[0078] (1) Cutting part of the fin rays of the oval pomfret to extract the total DNA, the extraction and storage method and DNA quality requirements are the same as those described in Example 1. Use SNP primer software to design specific amplification primers based on the base sequence of 120 bp upstream and downstream of the SNP marker described in the present invention as a template.

[0079] (2) PCR amplification

[0080] PCR primers:

[0081] SNP24144184FC (SEQ ID NO. 2):

[0082] GAAGGTGACCAAGTTCATGCTGGCTGAAGTCAGAGATGTGACTCTC

[0083] SNP24144184FG (SEQ ID NO. 3):

[0084] GAAGGTCGGAGTCAAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a SNP molecular marker related to a hypoxia resistance trait of Trachinotus ovatus. A sequence of the SNP molecular marker is shown in SEQ ID NO. 1, a 121-th base from a 5'-terminal of the sequence shown in the SEQ ID NO. 1 is C or G, and the Trachinotus ovatus has longer survival time under the stress of hypoxia when the 121-th base of the SEQ ID NO. 1 is nucleotide G. The invention further discloses a primer pair for detecting the SNP molecular marker and a kit comprising the primer pair as well as the SNP molecular marker obtained through carrying out whole-genome resequencing typing on hypoxia-treated Trachinotus ovatus and carrying out whole-genome associative analysis. According to the SNP molecular marker, breeding materials for the Trachinotus ovatus can be early selected, and the efficiency and accuracy of breeding the Trachinotus ovatus with the hypoxia resistance trait are effectively improved. The invention provides a novel SNP molecular marker for molecular-marker-assisting selection of the hypoxia resistance trait of the Trachinotus ovatus.

Description

technical field [0001] The invention belongs to the technical field of screening and assisted breeding of molecular markers of aquatic animals, and in particular relates to a SNP molecular marker related to hypoxia resistance traits of pomfret ovata and its application. Background technique [0002] Oval pomfret, commonly known as golden pomfret, is widely distributed in tropical and subtropical waters in the Indian Ocean, Mediterranean Sea and East China Sea. It is one of the marine fish with the most commercial farming value in southern my country. Many factors affect the development of pomfret pompano aquaculture industry, such as environment, feed, seed quality and so on. Dissolved oxygen is an important environmental factor. During the breeding process, the death of Pomfret ovata due to hypoxia has caused huge economic losses to farmers. Fish get their oxygen from oxygenated water flowing through their gill tissues. A water body with sufficient dissolved oxygen and h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6888C12Q1/6858C12Q1/6809C12N15/11
CPCC12Q1/6888C12Q1/6858C12Q1/6809C12Q2600/124C12Q2600/156C12Q2600/172C12Q2531/113C12Q2563/107C12Q2535/122C12Q2537/165
Inventor张殿昌刘宝锁伞利择刘波郭华阳朱克诚郭梁张楠
OwnerSOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI