Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

ALDH2 gene polymorphism detection kit and detection method

A technology of gene polymorphism and detection kit, which is applied in the field of biomedical gene detection, can solve the problems of long cycle time, extremely high requirements on instrument parameters, and expensive mass spectrometry instruments

Active Publication Date: 2021-07-27
INST OF URBAN ENVIRONMENT CHINESE ACAD OF SCI
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disadvantage is that the modified technology has extremely high requirements on the parameters of the PCR instrument, the equipment is expensive, and usually the difference in Tm of a single base mutation is less than 0.5°C, especially for the identification of heterozygous mutations
[0008] 4. Sequencing method, as the gold standard for mutation screening, but it involves multiple steps such as PCR amplification, purification, and on-machine sequencing. The cycle is long and overlapping peaks are prone to occur during the sequencing process, which affects genotype discrimination
The disadvantage is that this technology needs to combine multiple steps such as PCR amplification, restriction enzyme digestion, desalting and purification, and mass spectrometry equipment is expensive

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ALDH2 gene polymorphism detection kit and detection method
  • ALDH2 gene polymorphism detection kit and detection method
  • ALDH2 gene polymorphism detection kit and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] A kind of embodiment that relates to ALDH2 gene polymorphism detection primer set of the present invention, comprises following primer and probe:

[0076] ALDH2 (rs671, c.1510G>A) polymorphic site detection primer: nucleotide sequence as shown in SEQ ID No.1 upstream non-restrictive primer, nucleotide sequence as shown in SEQ ID No.2 The downstream restriction primer and the nucleotide sequence of the probe shown in SEQ ID No.3.

[0077] Wherein, the 3' segment of the probe whose nucleotide sequence is shown in SEQ ID No.3 is modified with C3 Spacer.

[0078] The designed PCR primers and probe sequences are shown in Table 1:

[0079] Table 1

[0080] name Sequence (5'-3') base number SEQ ID No.1 ALDH2-F GTTTGGAGCCCAGTCACCCTT 21 SEQ ID No.2 ALDH2-R AGCCACCAGCAGACCCTCAAGC 22 SEQ ID No.3 ALDH2-P CAGTTTTTCACTTCAGTGTATGCCTGCAGCCCGC3Spacer 32

Embodiment 2

[0082] An embodiment of the ALDH2 gene polymorphism detection kit related to the present invention, including the primers and probes of embodiment 1, and 2×PCR Master Mix reaction premix and plasmid standard; wherein:

[0083] Plasmid standards include ALDH2*1*1 (GG) plasmid standard (as shown in SEQ ID No.4), ALDH2*2*1 plasmid standard (as shown in SEQ ID No.5) and ALDH2*2*2 (AA) Plasmid standard (as shown in SEQ ID No. 6).

[0084] The components contained in the 2×PCR Master Mix reaction premix and their corresponding concentrations are: Tris-HCl 5mM-25mM, dNTP 0.2mM-0.8mM, MgCl 2 1.0mM-6.0mM, KCl 10mM-50mM, hot start DNA polymerase 0.05U / μL-0.2U / μL, uracil DNA glycosylase 0.01U / μL-0.1U / μL, SYTO-9 dye 0.5μM-2.5 μM, pH 8.0-9.5.

[0085] The final working concentration of the corresponding primers is: 0.05 μM-0.5 μM of the upstream non-restrictive primer with the nucleotide sequence shown in SEQ ID No.1, 0.01 μM with the downstream restrictive primer with the nucleotide seq...

Embodiment 3

[0093] The kit of Example 2 is used to detect the ALDH2 (rs671, c.1510G>A) gene polymorphism site of the saliva sample, including the following steps:

[0094] 1. Saliva sample processing

[0095] Use a saliva collector to collect saliva. After briefly vortexing the sample for 10s, heat the sample in a metal bath or water bath at 100°C for 10 minutes to release the exfoliated cell DNA in the saliva and inactivate PCR inhibitors. After cooling, briefly vortex for 10 seconds, and then centrifuge at 3000rpm for 5 minutes. , Take 3 μL of the supernatant and use it directly in the PCR reaction template.

[0096] Biological samples can also be used for PCR after DNA extraction.

[0097] 2. PCR reaction system preparation and PCR amplification

[0098] The PCR reaction was prepared according to the reaction system shown in Table 2. The amplification reaction was prepared according to the PCR amplification program shown in Table 3.

[0099] Table 2, PCR amplification reaction syste...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an ALDH2 gene polymorphism detection kit and a detection method. The kit comprises an asymmetric primer aiming at an ALDH2 gene polymorphism site and a probe with a closed 3' end; the asymmetric primer comprises an upstream non-restrictive primer of which the nucleotide sequence is as shown in SEQ ID No. 1 and a downstream restrictive primer of which the nucleotide sequence is as shown in SEQ ID No. 2; and the nucleotide sequence of the probe with the closed 3' end is as shown in SEQ ID No.3. According to the present invention, the base melting temperature Tm difference of the SNP single site can be increased from 0.5 DEG C to 5 DEG C, the requirements on the detection channel and the high resolution melting curve parameter of the PCR instrument are reduced, the PCR instrument with multiple fluorescence detection channels is not required, and the ALDH2 gene (rs671, c.1510G > A) polymorphic site can be directly detected and analyzed by using the common single fluorescence detection channel instrument; therefore, the device is suitable for popularization and use in common experimental instrument platforms.

Description

technical field [0001] The invention relates to the technical field of biomedical gene detection, in particular to an ALDH2 gene polymorphism detection kit and detection method. Background technique [0002] Alcohol is mainly metabolized in the liver, and the acetaldehyde produced during the metabolism accumulates in the body, which can cause blood vessels to dilate and cause discomfort symptoms such as flushing, nausea, sweating, and elevated skin temperature. Studies have confirmed that acetaldehyde has cytotoxic and carcinogenic effects, and excessive accumulation of acetaldehyde in the body may increase the risk of alcoholic liver disease. Acetaldehyde dehydrogenase ALDH2, as an important rate-limiting enzyme of acetaldehyde metabolism, can catalyze the conversion of acetaldehyde to acetic acid, thereby achieving detoxification. [0003] The ALDH2 gene rs671SNP (rs671, c.1510G>A) site was mutated from Niaoyin G to adenoid A, resulting in a decrease in the catalytic a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6858
CPCC12Q1/6883C12Q1/6858C12Q2600/156C12Q2531/107C12Q2521/531C12Q2563/173
Inventor 田美平黄清育
Owner INST OF URBAN ENVIRONMENT CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com