Genetic fluorescent probe for detecting mitochondrial membrane potential and application thereof
A technology of fluorescent probes and mitochondrial membranes, which is applied in the field of cell biology, can solve problems such as the whole process of difficult diseases, the influence of mitochondria, and non-heritability, and achieve the effects of easy storage, low biological toxicity, and simple preparation methods
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Embodiment 1, the acquisition of wild-type PINK1 gene and recombinant plasmid
[0024] The sequence of the human phosphatase and tensin homologue (PTEN)-induced kinase 1 (PTEN-inducedkinase1, PINK1) gene published on NCBI, as shown in SEQ ID NO.1 (Gene ID: 65018), using NCBI tools primerBLAST selects specific primers, and the specific primer sequences are as follows:
[0025] PINK1-F: gaattc atggcggtgcgacaggcgctgg (SEQ ID NO. 2);
[0026] PINK1-R: gcggccgc tcacagggctgccctccatgag (SEQ ID NO.3)
[0027] GAATTC (EcoR I restriction site) was added before the forward primer ATG, and gcggccgc (Not I restriction site) was added after the stop codon TGA of the reverse primer. The primers were synthesized by Beijing Huada Gene Technology Co., Ltd. Subsequently, PCR was used to amplify the wild-type PINK1 gene from the cDNA of HEK293T cells, and then the wild-type PINK1 gene was double-digested with restriction endonucleases EcoRI and Not I. At the same time, the restrictio...
Embodiment 2
[0028] Embodiment 2, the acquisition of red fluorescent protein gene and recombinant plasmid
[0029] The red fluorescent protein sequence shown in SEQ ID NO.4 was obtained from the plasmid pcDNA3.1(+)-RFP kept in the laboratory, and the sequence of the red fluorescent protein was added before the start codon ATG gcggccgcgg ccacc (Not I restriction site and Kozak sequence), add TCTAGA (XbaI restriction site) after the stop codon, design the corresponding primers, and the primers are synthesized by Beijing Huada Gene Technology Co., Ltd. The specific primer sequences are as follows:
[0030] mRFP-F: gcggccgc GGCCACCatggcctcctccgaggacgt (SEQ ID NO. 5);
[0031] mRFP-R: tctaga ttaggcgccggtggagtggc (SEQ ID NO. 6);
[0032] Subsequently, the red fluorescent protein gene was amplified from the plasmid pcDNA3.1(+)-RFP by PCR, and then the red fluorescent protein gene was double-digested with restriction endonucleases Not I and Xba I. Dicer Not I and Xba I were used to double-d...
Embodiment 3
[0033] Example 3, Detection of mitochondrial membrane potential heritable fluorescent probe gene and acquisition of recombinant plasmids
[0034]In order to retain the sensitivity of the PINK1 gene to changes in membrane potential and at the same time remove the ability of PINK1 to mediate mitophagy, the present invention removes the nucleotide sequence after 480 bp of the PINK1 gene (SEQ ID NO.1), that is, the PINK1 enzyme activity region and In the C-terminal region, the optimal PINK1 N-terminal nucleotide sequence that can respond to changes in mitochondrial membrane potential is screened from the remaining 1-480bp nucleotide sequences. By adding GAATTC (EcoR I restriction site) before the start codon ATG, and adding gcggccgc (Not I restriction site) after the PINK1 N-terminal sequence gene of different lengths, the primers were synthesized by Beijing Huada Gene Technology Co., Ltd. income. Subsequently, PINK1 N-terminal sequence genes of different lengths with restriction...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More