Unlock instant, AI-driven research and patent intelligence for your innovation.

PCR sequence combination for detecting hepatitis B virus and kit thereof

A hepatitis B virus, kit technology, applied in recombinant DNA technology, microbial determination/test, DNA/RNA fragment, etc., can solve the problem of limited sensitivity of fluorescent PCR, inability to detect residual virus, uncertain treatment and drug withdrawal To achieve the effect of reducing activity, high sensitivity and specificity

Inactive Publication Date: 2021-08-13
RAYBIOTECH INC GUANGZHOU
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, in terms of diagnosis and treatment observation methods, the technical method represented by fluorescent quantitative PCR has become the dominant method for hepatitis B virus detection, but its bottleneck problems are increasingly apparent, such as the limited sensitivity of fluorescent PCR, which cannot detect the existence of a very small number of residual viruses. Creates uncertainty about treatment and discontinuation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR sequence combination for detecting hepatitis B virus and kit thereof
  • PCR sequence combination for detecting hepatitis B virus and kit thereof
  • PCR sequence combination for detecting hepatitis B virus and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] 1. Preparation of reagents for PCR amplification reaction

[0037] The primers and probes used in this example are designed for the conserved regions of HBV DNA, and the specific sequence codes are shown in Table 1.

[0038]

[0039] The sequence used in this embodiment to prepare the HBV positive quality control product is HBV DNA gene amplified fragment H4, and its sequence code is:

[0040] TATCGCTGGATGTGTCTGCGGCGTTTTATTCATCTTCCTCTGCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATC.

[0041] The sequence used to prepare the ACTB internal standard in this embodiment is the ACTB gene amplification fragment STY11-6, and its sequence code is:

[0042] CGCAAGTACTCCGTGTGGATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGACGAGTCCGCCCCTCCATCGTCCACCGCAAATGCTTCTAGGCGGACTATGACTTAGTTGCGTTACACCCTTTCTTGACAAAACCTAACTTGCGCAGAAAAACAAGAT.

[0043] Use the above primers, probes, and gene amplification fragments to prepare the fol...

Embodiment 2

[0113] Based on the test results of Example 1, the present example uses 10% D-alpha-vitamin E polyethylene glycol succinate as a droplet stabilizer to add the HBV PCR reaction solution, and according to the PCR amplification method provided in Example 1, The preparation method of reagents for amplification reaction, using corresponding materials to prepare HBV PCR reaction solution, HBV strong positive quality control substance, HBV weak positive quality control substance, HBV negative quality control substance, ACTB internal standard substance, specific preparation method and implementation Example 1 remains the same, and will not be repeated here, wherein, in this embodiment, physiological saline is used as the HBV negative quality control product. The HBV PCR reaction liquid, HBV strong positive quality control, HBV weak positive quality control, HBV negative quality control, and ACTB internal standard prepared above were used to construct a kit for detecting hepatitis B vir...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a PCR (Polymerase Chain Reaction) sequence combination for detecting hepatitis B virus and a kit and a detection method applying the PCR sequence combination, wherein the PCR sequence combination for detecting hepatitis B virus comprises a primer HBV-F1, a primer HBV-R1, a primer HBV-R2, a primer HBV-R3, a probe HBV-P1, a primer ALD-F2, a primer ALD-R2, a probe ALD-P3-VIC and a gene amplification fragment H4 of HBV DNA (Deoxyribose Nucleic Acid), and the gene amplification fragment H4 of the HBV DNA is used for being matched with HBV negative serum to obtain an HBV positive quality control product. According to the invention, an upstream primer is designed for the HBV DNA conserved region, and a plurality of specific downstream primers and a specific Taqman probe for a common region are designed for different types of viruses, so that different types of HBV viruses can be detected, and the sensitivity and accuracy of HBV virus detection are improved.

Description

technical field [0001] The invention belongs to the technical field of biological detection, and in particular relates to a PCR reaction sequence combination and a kit for detecting hepatitis B virus. Background technique [0002] Due to the low early diagnosis rate of liver cancer, nearly 80% of the patients have already entered the middle and late stage once they are discovered, and lost the chance of radical surgical resection. However, the survival rate of early liver cancer after 5 years can reach 95%, which shows that early diagnosis, early Treatment is especially important for the treatment of patients with liver cancer. [0003] At present, in terms of diagnosis and treatment observation methods, the technical method represented by fluorescent quantitative PCR has become the dominant method for hepatitis B virus detection, but its bottleneck problems are increasingly apparent, such as the limited sensitivity of fluorescent PCR, which cannot detect the existence of a ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/706C12Q2563/159
Inventor 颜道宇黄若磐张新
Owner RAYBIOTECH INC GUANGZHOU