PCR sequence combination for detecting hepatitis B virus and kit thereof
A hepatitis B virus, kit technology, applied in recombinant DNA technology, microbial determination/test, DNA/RNA fragment, etc., can solve the problem of limited sensitivity of fluorescent PCR, inability to detect residual virus, uncertain treatment and drug withdrawal To achieve the effect of reducing activity, high sensitivity and specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] 1. Preparation of reagents for PCR amplification reaction
[0037] The primers and probes used in this example are designed for the conserved regions of HBV DNA, and the specific sequence codes are shown in Table 1.
[0038]
[0039] The sequence used in this embodiment to prepare the HBV positive quality control product is HBV DNA gene amplified fragment H4, and its sequence code is:
[0040] TATCGCTGGATGTGTCTGCGGCGTTTTATTCATCTTCCTCTGCATCCTGCTGCTATGCCTCATCTTCTTGTTGGTTCTTCTGGACTATCAAGGTATGTTGCCCGTTTGTCCTCTAATTCCAGGATC.
[0041] The sequence used to prepare the ACTB internal standard in this embodiment is the ACTB gene amplification fragment STY11-6, and its sequence code is:
[0042] CGCAAGTACTCCGTGTGGATCGGCGGCTCCATCCTGGCCTCGCTGTCCACCTTTCCAGCAGATGTGGATCAGCAAGCAGGAGTATGACGAGTCCGCCCCTCCATCGTCCACCGCAAATGCTTCTAGGCGGACTATGACTTAGTTGCGTTACACCCTTTCTTGACAAAACCTAACTTGCGCAGAAAAACAAGAT.
[0043] Use the above primers, probes, and gene amplification fragments to prepare the fol...
Embodiment 2
[0113] Based on the test results of Example 1, the present example uses 10% D-alpha-vitamin E polyethylene glycol succinate as a droplet stabilizer to add the HBV PCR reaction solution, and according to the PCR amplification method provided in Example 1, The preparation method of reagents for amplification reaction, using corresponding materials to prepare HBV PCR reaction solution, HBV strong positive quality control substance, HBV weak positive quality control substance, HBV negative quality control substance, ACTB internal standard substance, specific preparation method and implementation Example 1 remains the same, and will not be repeated here, wherein, in this embodiment, physiological saline is used as the HBV negative quality control product. The HBV PCR reaction liquid, HBV strong positive quality control, HBV weak positive quality control, HBV negative quality control, and ACTB internal standard prepared above were used to construct a kit for detecting hepatitis B vir...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


