Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Hyphantria cunea Iap gene dsRNA, and bacterial expression liquid and application thereof

A kind of American white moth, bacteria technology, applied in the direction of DNA / RNA fragment, application, genetic engineering, etc., to achieve the effect of good effectiveness and sensitivity, convenient operation and strong implementability

Active Publication Date: 2021-09-24
INST OF FOREST ECOLOGY ENVIRONMENT & PROTECTION CHINESE ACAD OF FORESTRY
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no documented research on the interference of the Iap gene of the American white moth

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hyphantria cunea Iap gene dsRNA, and bacterial expression liquid and application thereof
  • Hyphantria cunea Iap gene dsRNA, and bacterial expression liquid and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Embodiment 1, American white moth Iap gene full-length clone

[0025] (1) The larvae of H. americanum were collected, and the total RNA of H. americanum was extracted by TRIzol method (Trizol Plus reagent, Ambion, Austin, TX, USA).

[0026](2) Use the reverse transcription kit GoScriptTM Reverse Transcription System kit (Promega, Madison, WI, USA) to synthesize the first strand of cDNA. The reverse transcription system is: total RNA 1 μg, Oligo(dT) 15 Primer (500μg / ml) 0.5μL, GoScriptTM 5X Reaction Buffer 4μL, MgCl 2 (25mM) 1μL, Random Primers (500μg / ml) 0.5μL, PCR Nucleotide Mix 1μL, Recombinant Ribonuclease Inhibitor 0.4μL, GoScriptTM Reverse Transcriptase 1μL, Nuclease-Free Water make up 20μL. The reaction conditions are 42°C, 15min, 70°C, 15min.

[0027] (3) Design primers on both sides of the coding region sequence of the gene according to the transcriptome sequence of the larvae of the white moth. Primers were designed using Primer5 software to obtain forward...

Embodiment 2

[0033] Embodiment 2, the synthesis of American white moth Iap gene dsRNA

[0034] (1) The correct plasmid (plasmid having the sequence of SEQ ID NO.1) was verified by the sequencing result to continue PCR amplification with the dsRNA primers having the T7 promoter sequence, and the amplification method and system refer to the steps of the above-mentioned Example 1 ( 3). The amplified product is recovered and purified, and the recovery and purification method refers to the step (4) of the above-mentioned Example 1.

[0035] The PCR amplification primers are:

[0036] F: taatacgactcactataggGTTTTTATTGTGACGGTGGC (number in the sequence listing: SEQ ID NO.5)

[0037] R: taatacgactcactataggGTGTTTCTTCGTTAGGGGTT (number in the sequence listing: SEQ ID NO.6)

[0038] (2) The PCR amplification product obtained in the above step (1) is purified and recovered to serve as a template for dsRNA in vitro transcription.

[0039] dsRNA was synthesized in vitro using T7 RiboMAXTM Express RNA...

Embodiment 3

[0043] Embodiment 3, the preparation of expressing white moth Iap gene dsRNA bacterial expression bacterial liquid

[0044] (1) Select two restriction sites on the L4440 plasmid (Addgene Company), which are Bgl II (AGATCT) and PstI (CTGCAG), respectively, and use the cDNA of the white moth as a template, with corresponding restriction sites and protection Base dsHcIap primers are used for PCR amplification, and the amplification method and system refer to the step (3) of the above-mentioned Example 1. The amplified product is recovered and purified, and the recovery and purification method refers to the step (4) of the above-mentioned Example 1.

[0045] The dsHcIap primer is:

[0046] F: GAAGATCTTCGTTTTTATTGTGACGGTGGC (number in the sequence listing: SEQ ID NO.7)

[0047] R: AACTGCAGAACCAATGCATTGGTGTTTCTTCGTTAGGGGTT sequence (number in the list: SEQ ID NO.8)

[0048] (2) Use BglII and PstI (Takara) to linearize the L4440 vector according to the sequences of the two restric...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses Hyphantria cunea Iap gene dsRNA and a bacterial expression liquid thereof. The nucleotide sequence of the Iap gene dsRNA fragment is shown in SEQ ID NO. 2. According to the invention, a large amount of required exogenous target dsRNA is expressed in Escherichia coli HT115 by using recombinant plasmid; after the Escherichia coli HT115 bacterial liquid for IPTG induced expression of the target dsRNA is continuously fed, the bacterial expression liquid has high lethal ability to Hyphantria cuneas and significant inhibitory effect on the growth and development of the Hyphantria cuneas; and a method for preventing and treating the Hyphantria cuneas by using the bacterial expression liquid provided by the invention has the advantages of strong practicability, convenient operation, good effectiveness and sensitivity, high insecticidal efficiency, environmental friendliness, etc., and has good application prospects.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a dsRNA of the American white moth lap gene and its bacterial expression bacterial solution and application. Background technique [0002] The American white moth (Hyphantria cunea) belongs to the family Lepidoptera and is an extremely dangerous invasive forestry pest in my country. Its host plants are very wide and can eat almost all kinds of cultivated trees, flowers and crops. The larvae live in groups Feeds on leaves, eats a lot, and has strong adaptability. Adults have strong reproductive ability, and each female lays 800-900 eggs on average, with a maximum of more than 2,000 eggs. At the same time, the dispersal ability of adults is also very strong, and the males can fly more than 7 kilometers on average within 12 hours, and the maximum can exceed 23 kilometers. These characteristics make the American white moth very easy to break out and cause disasters. Since the American w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/70A01N57/16A01P7/04
CPCC12N15/113C12N15/70A01N57/16C12N2310/14C12N2330/51
Inventor 张真张珣张苏芳孔祥波刘福樊智智方加兴
Owner INST OF FOREST ECOLOGY ENVIRONMENT & PROTECTION CHINESE ACAD OF FORESTRY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com