Method for advancing rice growth period and increasing yield by using mutant OsHsfC2a gene

A technology for the growth period and growth period of rice, which is applied in the directions of biochemical equipment and methods, genetic engineering, plant genetic improvement, etc., to achieve the effects of less damage, increased total grain number, and increased yield

Active Publication Date: 2021-10-19
SOUTH CHINA AGRI UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Prior art CN108103092A, although it is disclosed that the use of CRISPR-Cas technology to mutate rice genes can obtain rice plants with changed trai

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for advancing rice growth period and increasing yield by using mutant OsHsfC2a gene
  • Method for advancing rice growth period and increasing yield by using mutant OsHsfC2a gene
  • Method for advancing rice growth period and increasing yield by using mutant OsHsfC2a gene

Examples

Experimental program
Comparison scheme
Effect test

Example Embodiment

[0046] Example 1 Rice plants in advance in the growth period of the OsHSFC2A gene in Japonica rice varieties

[0047] 1. Target sequence design:

[0048] Target-HSFC2A-U3 (SEQ ID No.4): ccgacgcgtcatcctg

[0049] 2. Construction of PU3-GRNA vectors containing Target-HSFC2A-U3:

[0050] First, the target primer with viscous end is first synthetic-HSFC2A-U3F (SEQ ID No.5): GGCaccgcgcgtccctg, Target-HSFC2A-U3R (SEQ ID No.6): aaaccaggcgatgcccgtcgg; rewinding the joint primer to room temperature and cooling The annealed primer is linked to a PU3-GRNA vector after sliced; positive particles are verified by PCR amplification and sequencing;

[0051] 3. PCRISPR / CAS9 vector constructs containing Target-HSFC2A fragment:

[0052] The expression cassette containing the Target-HSFC2A-U3 fragment is cut from the PU3-GRNA vector, and then attached to the PCRISPR / Cas9 vector containing the Cas9 expression cassette;

[0053] 4. Gas of transgenic plants:

[0054] The target-based PCRISPR / Cas9 ...

Example Embodiment

[0063] Example 2 The OsHSFC2A gene was used to obtain a plant in advance in the heading time of the OsHSFC2A gene in the Japonica rice variety.

[0064] 1. Target sequence design:

[0065] Target-HSFC2A-U6 (SEQ ID NO.11): TCGCACGATCCGCGCGCAGC

[0066] 2. Construction of PU6-GRNA vectors containing Target-HSFC2A-U6 fragments,

[0067] First, the target primer of the viscous end is first synthetic-HSFC2A-U6 F (SEQ ID No. 12): gccgtcgcccgggcagcc, target-hsfc2a-u6 r (SEQ ID NO.13): AAACGCTGCGCGGTGTGCGA; re-shifting the joint primer and shift to room temperature cooling After the annealing, the annealed primer is linked to a PU6-GRNA carrier after exchanger; the yang-positive plasmid is verified by PCR amplification and sequencing;

[0068] 3. PCRISPR / CAS9 vector construction containing Target-OSHSFC2A fragment:

[0069] The expression cassette containing the target-OSHSFC2A-U6 fragment is cut from the PU6-GRNA vector and then attached to the PCRISPR / Cas9 vector containing the Cas9...

Example Embodiment

[0086] Example 3 Characterization of transgenic plants obtained by CRISPR / Cas9 system mutant OsHSFC2A at different sunshine time

[0087] Example 1 was identified by PCR and sequencing the mutated transfusion to mature, observing the plants in different periods, and the resulting transformed plants exhibited normal phenotypes from the appearance. Plant morphology results in different periods figure 1 Indicated.

[0088] The rotational plant and the suede of the plants of the plant, the species of the rice varieties, such as figure 2 As shown, the number of total particles per panicle is image 3 As shown, Figure 4 Indicated.

[0089] The present invention performs OsHSFC2A mutation rice, under natural long sunshine conditions, the heading time is significantly reduced; the total number of total particles per panicle increases.

[0090] Compared to wild-type rice without mutant OsHSFC2A, the heading time of CashSFC2A-1 and CasHSFC2A-2 plants decreased by 7 days and 6 days, respect...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention belongs to the field of rice gene engineering, and relates to a method for advancing the growth period of rice or increasing the yield of rice by using a mutant OsHsfC2a gene. Researches show that after the OsHsfC2a gene is subjected to mutation reduction/blocking expression, the growth period of rice under long and short sunshine is obviously shortened, and the OsHsfC2a gene can be used as an effective target for rice genetic breeding. In addition, compared with mutants obtained through chemical and physical mutagenesis, the mutant obtained through a CRISPR/Cas9 system is higher in purposiveness, damage to genomes is small, and possible risks caused by transgenosis can be avoided. Compared with a wild type which is not mutated, the method has the advantages that the heading time of the mutated CasHsfC2a plant is shortened by 4-7 days under long and short sunshine, the total grain number of each spike is increased, the maturing rate is not reduced, and the growth state of the plant is not influenced.

Description

technical field [0001] The invention belongs to the field of rice genetic engineering, and in particular relates to a method for advancing the growth period of rice and improving yield by using a mutant OsHsfC2a gene. Background technique [0002] Rice (Oryza sativa L.) is an important food crop in the world and a monocot model plant for functional research. At present, the global population is increasing, the area of ​​arable land is decreasing sharply, the environment is polluted seriously, extreme weather occurs frequently, and the supply and demand of food become unbalanced (Gupta PK, Rustgi S and Kumar N(2006). Genetic and molecular basis of grain size and grain number and its relevance to grain productivity higher plants. Genome 49(6):565-571.). Heading date is a key agronomic trait that affects regional adaptability and yield of rice, and it is jointly regulated by the external environment and rice flowering genes. Judging from the current research, although there a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/29C12N15/84C12N15/55A01H5/00A01H6/46
CPCC07K14/415C12N15/8218C12N15/8261C12N15/8205C12N9/22
Inventor 庄楚雄郑少燕于迪卢静沁叶思苗
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap