Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for advancing rice growth period and increasing yield by using mutant OsHsfC2a gene

A technology for the growth period and growth period of rice, which is applied in the directions of biochemical equipment and methods, genetic engineering, plant genetic improvement, etc., to achieve the effects of less damage, increased total grain number, and increased yield

Active Publication Date: 2021-10-19
SOUTH CHINA AGRI UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Prior art CN108103092A, although it is disclosed that the use of CRISPR-Cas technology to mutate rice genes can obtain rice plants with changed traits (dwarfing), but there is no regulation of rice growth period by mutating rice heat shock proteins or heat shock transcription factors. to report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for advancing rice growth period and increasing yield by using mutant OsHsfC2a gene
  • Method for advancing rice growth period and increasing yield by using mutant OsHsfC2a gene
  • Method for advancing rice growth period and increasing yield by using mutant OsHsfC2a gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1 Using the CRISPR / Cas9 system to mutate the OsHsfC2a gene in the indica rice variety Nanguizhanzhong to obtain rice plants with an advanced growth period

[0047] 1. Target sequence design:

[0048] Target-HsfC2a-U3 (SEQ ID NO.4): CCGACGGCGTCATCGCCTG

[0049] 2. Construction of pU3-gRNA vector containing Target-HsfC2a-U3:

[0050] First synthesize the target primer pair Target-HsfC2a-U3F (SEQ ID NO.5): GGCACCGACGGCGTCATCGCCTG, Target-HsfC2a-U3R (SEQ ID NO.6): AAACCAGGCGATGACGCCGTCGG with sticky ends; denature the linker primers and move them to room temperature to complete annealing , link the annealed primers to the digested pU3-gRNA carrier; verify the positive plasmid by PCR amplification and sequencing;

[0051] 3. Construction of pCRISPR / Cas9 vector containing Target-HsfC2a fragment:

[0052] Cut the expression cassette containing the Target-HsfC2a-U3 fragment from the pU3-gRNA vector, and then connect it to the pCRISPR / Cas9 vector containing the Cas9 e...

Embodiment 2

[0063] Example 2 Mutation of the OsHsfC2a gene in the indica rice variety Nanguizhan using the CRISPR / Cas9 system to obtain plants with early heading time

[0064] 1. Target sequence design:

[0065] Target-HsfC2a-U6 (SEQ ID NO. 11): TCGCACGATCCGGCGCAGC

[0066] 2. Construction of pU6-gRNA vector containing Target-HsfC2a-U6 fragment,

[0067] First synthesize the target primer pair Target-HsfC2a-U6 F (SEQ ID NO.12): GCCGTCGCACGATCCGGCGCAGC, Target-HsfC2a-U6 R (SEQ ID NO.13): AAACGCTGCGCCGGATCGTGCGA; denature the adapter primers and move to room temperature for cooling Complete annealing, link the annealed primers to the digested pU6-gRNA carrier; verify the positive plasmid by PCR amplification and sequencing;

[0068] 3. Construction of pCRISPR / Cas9 vector containing Target-OsHsfC2a fragment:

[0069] Cut the expression cassette containing the Target-OsHsfC2a-U6 fragment from the pU6-gRNA vector, and then connect it to the pCRISPR / Cas9 vector containing the Cas9 expression...

Embodiment 3

[0086] Example 3 Character identification of transgenic plants obtained by using CRISPR / Cas9 system to mutate OsHsfC2a under different lengths of sunshine

[0087] The mutant transgenic plants identified by PCR and sequenced in Example 1 were cultivated to maturity, and the morphology of the plants at different stages was observed. The obtained transformed plants all showed normal phenotypes in appearance. The results of plant morphology in different periods are as follows: figure 1 shown.

[0088] The heading time of the transformed plants and the control plants of the indica rice variety Nanguizhan were as follows: figure 2 As shown, the total number of grains per panicle is as image 3 As shown, the seed setting rate is as Figure 4 shown.

[0089] In the rice with the OsHsfC2a mutation, the heading time is significantly reduced and the total number of grains per panicle is increased under natural long-day sunshine conditions.

[0090] Compared with wild-type rice wit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of rice gene engineering, and relates to a method for advancing the growth period of rice or increasing the yield of rice by using a mutant OsHsfC2a gene. Researches show that after the OsHsfC2a gene is subjected to mutation reduction / blocking expression, the growth period of rice under long and short sunshine is obviously shortened, and the OsHsfC2a gene can be used as an effective target for rice genetic breeding. In addition, compared with mutants obtained through chemical and physical mutagenesis, the mutant obtained through a CRISPR / Cas9 system is higher in purposiveness, damage to genomes is small, and possible risks caused by transgenosis can be avoided. Compared with a wild type which is not mutated, the method has the advantages that the heading time of the mutated CasHsfC2a plant is shortened by 4-7 days under long and short sunshine, the total grain number of each spike is increased, the maturing rate is not reduced, and the growth state of the plant is not influenced.

Description

technical field [0001] The invention belongs to the field of rice genetic engineering, and in particular relates to a method for advancing the growth period of rice and improving yield by using a mutant OsHsfC2a gene. Background technique [0002] Rice (Oryza sativa L.) is an important food crop in the world and a monocot model plant for functional research. At present, the global population is increasing, the area of ​​arable land is decreasing sharply, the environment is polluted seriously, extreme weather occurs frequently, and the supply and demand of food become unbalanced (Gupta PK, Rustgi S and Kumar N(2006). Genetic and molecular basis of grain size and grain number and its relevance to grain productivity higher plants. Genome 49(6):565-571.). Heading date is a key agronomic trait that affects regional adaptability and yield of rice, and it is jointly regulated by the external environment and rice flowering genes. Judging from the current research, although there a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C12N15/84C12N15/55A01H5/00A01H6/46
CPCC07K14/415C12N15/8218C12N15/8261C12N15/8205C12N9/22
Inventor 庄楚雄郑少燕于迪卢静沁叶思苗
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com