Method for advancing rice growth period and increasing yield by using mutant OsHsfC2a gene
A technology for the growth period and growth period of rice, which is applied in the directions of biochemical equipment and methods, genetic engineering, plant genetic improvement, etc., to achieve the effects of less damage, increased total grain number, and increased yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] Example 1 Using the CRISPR / Cas9 system to mutate the OsHsfC2a gene in the indica rice variety Nanguizhanzhong to obtain rice plants with an advanced growth period
[0047] 1. Target sequence design:
[0048] Target-HsfC2a-U3 (SEQ ID NO.4): CCGACGGCGTCATCGCCTG
[0049] 2. Construction of pU3-gRNA vector containing Target-HsfC2a-U3:
[0050] First synthesize the target primer pair Target-HsfC2a-U3F (SEQ ID NO.5): GGCACCGACGGCGTCATCGCCTG, Target-HsfC2a-U3R (SEQ ID NO.6): AAACCAGGCGATGACGCCGTCGG with sticky ends; denature the linker primers and move them to room temperature to complete annealing , link the annealed primers to the digested pU3-gRNA carrier; verify the positive plasmid by PCR amplification and sequencing;
[0051] 3. Construction of pCRISPR / Cas9 vector containing Target-HsfC2a fragment:
[0052] Cut the expression cassette containing the Target-HsfC2a-U3 fragment from the pU3-gRNA vector, and then connect it to the pCRISPR / Cas9 vector containing the Cas9 e...
Embodiment 2
[0063] Example 2 Mutation of the OsHsfC2a gene in the indica rice variety Nanguizhan using the CRISPR / Cas9 system to obtain plants with early heading time
[0064] 1. Target sequence design:
[0065] Target-HsfC2a-U6 (SEQ ID NO. 11): TCGCACGATCCGGCGCAGC
[0066] 2. Construction of pU6-gRNA vector containing Target-HsfC2a-U6 fragment,
[0067] First synthesize the target primer pair Target-HsfC2a-U6 F (SEQ ID NO.12): GCCGTCGCACGATCCGGCGCAGC, Target-HsfC2a-U6 R (SEQ ID NO.13): AAACGCTGCGCCGGATCGTGCGA; denature the adapter primers and move to room temperature for cooling Complete annealing, link the annealed primers to the digested pU6-gRNA carrier; verify the positive plasmid by PCR amplification and sequencing;
[0068] 3. Construction of pCRISPR / Cas9 vector containing Target-OsHsfC2a fragment:
[0069] Cut the expression cassette containing the Target-OsHsfC2a-U6 fragment from the pU6-gRNA vector, and then connect it to the pCRISPR / Cas9 vector containing the Cas9 expression...
Embodiment 3
[0086] Example 3 Character identification of transgenic plants obtained by using CRISPR / Cas9 system to mutate OsHsfC2a under different lengths of sunshine
[0087] The mutant transgenic plants identified by PCR and sequenced in Example 1 were cultivated to maturity, and the morphology of the plants at different stages was observed. The obtained transformed plants all showed normal phenotypes in appearance. The results of plant morphology in different periods are as follows: figure 1 shown.
[0088] The heading time of the transformed plants and the control plants of the indica rice variety Nanguizhan were as follows: figure 2 As shown, the total number of grains per panicle is as image 3 As shown, the seed setting rate is as Figure 4 shown.
[0089] In the rice with the OsHsfC2a mutation, the heading time is significantly reduced and the total number of grains per panicle is increased under natural long-day sunshine conditions.
[0090] Compared with wild-type rice wit...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com