A protein ptsuobp16 combined with a variety of volatile compounds of camphor, the attractant of camphor dentatus and its application
A technology of volatile compounds and compounds, applied in the field of molecular biology, can solve problems such as odor-binding proteins OBPs that have not been reported
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Cloning of PtsuOBP16 Gene
[0039] (1) Breeding of Cinnamomum camphorata
[0040] During rearing, gauze was used to separate male and female adults of C. camphorata in the middle of the rearing box, and male and female adults of the same batch of eclosion (35 days old, feeding normally but not mating) were collected for transcriptome sequencing. Three independent biological replicates were set for male and female adults, and each replicate contained 6 adults of the same sex. After all samples were collected at the same time and washed with 75% alcohol, they were immediately frozen in liquid nitrogen and stored at -80°C or directly subjected to total RNA extraction.
[0041] (2) RNA extraction from male and female adults of C. camphora
[0042] Select TRIzol (Tao Bioengineering (Dalian) Co., Ltd. TaKaRa, Japan) method to extract the total RNA of the male and female adults of Cinnamomum camphorata, and the extraction steps are as follows:
[0043] (1) Put each collecte...
Embodiment 2
[0094] Relative expression of PtsuOBP16 gene in male and female adult tissues of C. camphorata
[0095] (1) Breeding and collection of samples
[0096] The field collection and rearing of Cinnamomum camphora are the same as those in Example 1. During rearing, the male and female adults were separated by gauze in the middle of the rearing box, and the male and female adults of the same batch of eclosion (35 days old, feeding normally but not mating) were collected for dissection. Three independent biological replicates were set for male and female adults, and each replicate contained 30 adults of the same sex. After all samples were collected at the same time and washed with 75% alcohol, they were immediately dissected on ice to obtain antennae, head (without antennae), thorax, abdominal ends, wings and feet and other tissues, and quickly placed in liquid nitrogen for freezing. Immediately after freezing, store at -80°C or proceed directly to total RNA extraction.
[0097] (...
Embodiment 3
[0117] Prokaryotic expression and purification of PtsuOBP16
[0118] (1) Construction of prokaryotic expression vector based on the principle of homologous recombination
[0119] (1) The signal peptide sequence (SEQ ID NO: 9: ATGAAACACTTCATTGCTGTGCTTCTCTGCGCCCTTGTTGCATCTGCTCTGGCA) of PtsuOBP16 was removed, and the primer design software CE Design ( http: / / www.vazyme.com , Novizan official website) to design the target fragment primers containing the homologous sequences at both ends of the linearized vector; the primers for the construction of the PtsuOBP16 prokaryotic expression vector are as follows:
[0120] F: 5'-cgcggatccgaattcgagctcAGACCCGAAGTTAACCAGGATG-3' (SEQ ID NO: 7);
[0121] R: 5'-tggtggtgctcgagtgcggccgcTTAATGGTGAGGAGGAGGAGGG-3' (SEQ ID NO: 7). The lowercase letters are the restriction sites.
[0122] (2) The expression vector pET28a(+) was double digested with two restriction enzymes to linearize the pET28a(+). The PCR reaction system is shown in Table 7.
...
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
| PCR efficiency | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More