Preparation method and application of recombinant VEGFB
A purification method and technology of equilibration liquid, applied in the biological field, can solve the problems of unsatisfactory recovery rate and purity, many steps, complicated process, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0072] The present invention provides a preparation method and application of recombinant VEGFB, and those skilled in the art can refer to the content of this article and appropriately improve the process parameters to realize it. What needs to be pointed out in particular is that all similar replacements and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously make changes or appropriate changes and combinations to the method and application herein without departing from the content, spirit and scope of the present invention to realize and apply the present invention Invent technology.
[0073] The test materials used in the present invention are all common commercially available products, which can be purchased in the market.
Embodiment 1
[0076] 1. By bioinformatics methods, the VEGFB nucleic acid sequence obtained by searching in the NCBI database is as follows.
[0077] >VEGFB-544bp
[0078] gaattcATGCCGGTGTCTCAGCCGGATGCGCCGGGTCACCAACGTAAA GTGGTTAGCTGGATCGATGTTTACACCCGTGCGACCTGCCAGCCGCGTG AGGTGGTTGTGCCGCTGACCGTGGAACTGATGGGCACCGTTGCGAAGC AGCTGGTGCCGAGCTGCGTTACCGTGCAACGTTGCGGTGGCTGCTGCCC GGATGATGGTCTGGAGTGCGTTCCGACCGGCCAGCACCAAGTGCGTATG CAGATCCTGATGATTCGTTATCCGAGCAGCCAACTGGGCGAGATGAGCCTGGAGGAACACAGCCAGTGCGAATGCCGTCCGAAGAAAAAGGACAGC GCGGTGAAGCCGGATAGCCCGCGTCCGCTGTGCCCGCGTTGCACCCAGC ATCATCAGCGTCCGGACCCGCGTACCTGCCGCTGCCGCTGCCGTCGTCG TAGCTTCCTGCGTTGCCAAGGTCGTGGCCTGGAACTGAACCCGGATACC TGCCGTTGCCGTAAGCTGCGTCGTGGCAGCCACCACCACCACCACCACT AAaagctt
[0079] According to the nucleic acid sequence information, the DNA of VEGFB is artificially synthesized.
[0080] 2. Using the DNA of the artificially synthesized VEGFB as a template to carry out PCR amplification.
[0081] Using the DNA of the artificially synthesized VEGFB ...
Embodiment 2
[0106] 1. Inclusion body dissolution
[0107] Dissolve 25 g of inclusion bodies (prepared in Example 1) in 250 ml of inclusion body solution, stir magnetically at room temperature until the solution is clear, centrifuge the solution at 10,000 rpm, 20 min, and 4°C, separate insoluble substances, and collect the supernatant liquid.
[0108] Inclusion body solution: Prepare 100ml according to the following proportions, dissolve in 80ml water, adjust pH to 8.5 and dilute to 100ml, ready for immediate use.
[0109] Tris 121mg NaH 2 PO 4 .2H 2 O(0.1M)
1.56g DTT (20mM) 0.309g Guanidine Hydrochloride (6M) 57.31g
[0110] 2 Affinity chromatography purification
[0111] ready to be fixed with Ni 2+ The chelating Sepharose Fast Flow column. Equilibrate the column with equilibration solution 1 and 3-5 volumes respectively, and the flow rate is 5-50ml / min. Load the dissolved sample at a flow rate of 5-50ml / min. Balance solution 2, balance sol...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com