Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

11[alpha]-hydroxylase mutant and application thereof

A technology of α-hydroxylase and mutants, applied in the fields of genetic engineering and enzyme engineering, can solve the problems of wasting raw materials, increasing the cost of separation and purification, etc.

Pending Publication Date: 2021-11-19
TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are obvious by-products in the transformation of steroidal substrate progesterone by Ochraus ochrax, which not only wastes raw materials, but also increases the cost of subsequent separation and purification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 11[alpha]-hydroxylase mutant and application thereof
  • 11[alpha]-hydroxylase mutant and application thereof
  • 11[alpha]-hydroxylase mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1: Construction of mutant I303L

[0027] 1. Amplify the target fragment by site-directed mutagenesis:

[0028] Using the plasmid pYES2-AOH as a template, the site-directed mutagenesis technique was used to carry out polymerase chain reaction, and the primers were synthesized by Tianjin Jinweizhi Biotechnology Co., Ltd.

[0029] AOH-CYP68J5m303-F: CTCTCCCTAGTTGCTATCCACCACCACG

[0030] AOH-CYP68J5m303-R: AGCAACTAGGGAGAGCGTGACCTGCTT

[0031] (1) PCR reaction system:

[0032]

[0033] (2) PCR reaction conditions:

[0034]

[0035] 2. Purification process after Dpn I enzyme digestion:

[0036] DpnI enzyme has a gatc base that recognizes methylation. The template plasmid is generally a plasmid with natural methylation modification extracted from Escherichia coli. Therefore, under the action of DpnI enzyme, the template plasmid is recognized and rapidly digested, while The PCR amplification of the new mutant plasmid has no methylation modification and wil...

Embodiment 2

[0064] Example 2: Construction of pPIC 3.5K-CYP68J5m303 recombinant plasmid

[0065] 1. PCR amplification of target fragment CYP68J5m303

[0066] The upstream and downstream primers with EcoRI and SnaBI restriction sites were designed according to the open reading frame, and the improved plasmid pYES2-CYP68J5m303 was used as a template for PCR amplification. The primers were synthesized by Tianjin Jinweizhi Biotechnology Co., Ltd.

[0067] AOH3.5K-F: GGtacgtaATGCCCTTTCTTCACTGGG

[0068] AOH3.5K-R: CGgaattcCTACACAGTTAAACTCGCC

[0069] (1) PCR reaction system:

[0070]

[0071] (2) PCR reaction conditions:

[0072] Set a pre-denaturation temperature of 95°C for 5 minutes, a denaturation temperature of 94°C for 45 seconds, an annealing temperature of 53°C for 45 seconds, and an extension temperature of 72°C for 2 minutes. After three cycles, the denaturation temperature was set to 95°C for 45 seconds. The annealing temperature of 60°C was reacted for 45s, and the extension...

Embodiment 3

[0082] Example 3: Construction of recombinant bacteria expressing hydroxylase with improved Pichia pastoris specificity

[0083] 1. Linearization of recombinant plasmid DNA

[0084] The use of a linearized vector can be more beneficial to obtain a positive recombinant Pichia pPIC3.5K-CYP68J5m303 transformant, so use the restriction endonuclease NcoI to digest the pPIC3.5K-CYP68J5m303 recombinant plasmid, and the 50 μL digestion system is as follows:

[0085]

[0086] Place in a 37°C incubator for digestion for 3 hours, and then use a small DNA purification kit to purify the fragments to eliminate the interference of Nco I enzyme Buffer plasma.

[0087] 2. Linearized plasmid electroporation into wild Pichia pastoris

[0088] (1) The Pichia pastoris GS115 strain stored in the laboratory was activated in three zones, cultured in a 30°C incubator for 48 hours, and a single colony of moderate size was picked and inoculated in 50ml of YPD liquid medium for amplified propagation ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an aspergillus ochraceus steroid C11[alpha]-hydroxylase mutant I303L, wherein the DNA sequence of the mutant I303L is shown as SEQ ID NO:2. Compared with C11[alpha]-hydroxylase CYP68J5, the mutant I303L shows higher specificity when being used for converting a steroid substrate progesterone, and no obvious by-product is generated. The invention also provides a heterologous overexpression expression vector based on the mutant I303L, a pichia pastoris recombinant strain and a steroid transformation process of the pichia pastoris recombinant strain, and valuable materials (genes and strains) and basic data support are provided for research and development of an efficient progesterone C11[alpha]-hydroxylation production process.

Description

Technical field: [0001] The invention belongs to the technical fields of genetic engineering and enzyme engineering, and specifically relates to a C11α-hydroxylase mutant and application thereof. Background technique: [0002] Steroid hormones are widely used clinically. These drugs are mainly used to treat conditions such as inflammation and allergies, but are also used to treat cancer, human hormone secretion disorders and birth control. The physiological and pharmacological activities of steroidal drugs depend on the introduction of functional groups at specific sites in the steroidal skeleton. The modification of the steroidal structure is by chemical synthesis or microbial transformation, or a combination of the two methods. The total chemical synthesis method has the disadvantages of complex synthesis process and difficult separation of by-products, so the key synthetic steps are difficult to complete by chemical synthesis. In industry, microbial transformation react...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/02C12N15/81C12N1/19C12P33/10C12R1/84
CPCC12N9/0004C12N15/815C12P33/10
Inventor 刘晓光郭文丽路福平
Owner TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com