Supercharge Your Innovation With Domain-Expert AI Agents!

Target PABPC1 related to leukemia diagnosis and treatment and application thereof

A technology for leukemia and leukemia cells, applied in the biological field, can solve the problems of leukemia without functional mechanism and few functional reports.

Active Publication Date: 2021-11-30
THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, the relevant research on PABPC1 mainly focuses on its regulation mechanism involved in various aspects of RNA metabolism, and there are few reports on its function in individual development and disease occurrence, and there is no report on the relevant functional mechanism in leukemia.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Target PABPC1 related to leukemia diagnosis and treatment and application thereof
  • Target PABPC1 related to leukemia diagnosis and treatment and application thereof
  • Target PABPC1 related to leukemia diagnosis and treatment and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1, the expression of PABPC1 increases in the process of CML blast

[0066] 1. The expression of PABPC1 increases in the process of CML blast

[0067] 1. Analysis of the differential expression of genes in the blast process of CML patients

[0068] Reference [Proc Natl Acad Sci U S A.2006Feb 21; 103(8):2794-9.], 57 cases of CML patients in chronic phase and 33 cases of CML patients in blast phase were analyzed for gene differential expression, and the top 1000 significant differences were selected Expressed genes are visualized in Heatmap. The result is as figure 1 As shown in A, the results show that the expression levels of a series of genes are significantly up-regulated and down-regulated during the blast transition from chronic phase to blast phase in CML.

[0069]2. GO function enrichment analysis

[0070] GO function enrichment analysis was performed on the genes that were differentially changed during the blast mutation process, and the Bubble chart w...

Embodiment 2

[0084] Example 2, PABPC1 promotes the occurrence and development of CML disease in vivo and in vitro

[0085] 1. Preparation of PABPC1-knockdown CML blast phase cell lines K562 and MEG-01

[0086] 1. Construction of lentiviral recombinant plasmid

[0087] (1) Preparation of recombinant plasmid

[0088] Design and synthesize shPABPC1-1 specifically targeting PABPC1, its coding sequence is as follows:

[0089] CCAGACCTCATCCATTCCAAACTCGAGTTTGGAATGGATGAGGTCTGG (SEQ ID NO: 1).

[0090] Design and synthesize specific shPABPC1-5 targeting PABPC1, its coding sequence is as follows:

[0091] AGCTGTTCCAACCCTGTAATCTCGAGATTACAGGGTTGGGAACAGC (SEQ ID NO: 2).

[0092] The above shRNA coding sequences were cloned into pLKO.1 lentiviral plasmid (Addgene) to obtain recombinant plasmids shPABPC1-1 and shPABPC1-2, respectively.

[0093] (2) Identification of recombinant plasmids

[0094] The recombinant plasmids were identified by PCR, and the correct recombinant plasmids identified by PCR ...

Embodiment 3

[0173] Example 3. Substances that inhibit the expression of PABPC1 can inhibit the proliferation of hematopoietic stem / progenitor cells in CML patients

[0174] 1. Separation and culture of bone marrow cells from CML patients CD34+ cells

[0175] Bone marrow CD34-positive cells were isolated and cultured from two patients with newly diagnosed CML (respectively denoted as chronic myelogenous leukemia patient No. 1 and chronic myelogenous leukemia patient No. 2), and the specific steps were as follows:

[0176] 1. Reagent preparation: sorting buffer (PBS, 2% FBS, 0.4% 0.5M EDTA, 1% double antibody), cell sorting-magnetic beads CD34 + (Miltenyi, 130-046-702), magnetic rack (Miltenyi), HISTOPAQUE-1077 (Sigma, 10771), serum-free cell freezing medium (ZENOAQ, Cell Banker 2-100).

[0177] 2. Separation of bone marrow single cells from CML patients: Dilute the bone marrow blood sample of CML patients with 4 times the volume of EDTA-PBS, carefully add it to Ficoll with a volume of 0.5...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a target PABPC1 related to leukemia diagnosis and treatment and application thereof. It is found that PABPC1 can promote the cell cycle and proliferation of a CML cell line in vitro and inhibit cell differentiation; the survival rate of the PABPC1 knocked-down group of mice is obviously improved; knock-down of PABPC1 in CML patient cells can significantly inhibit leukemia cell proliferation and clone formation, and promote cell apoptosis; the PABPC1 in the CML can be directly combined with the 3 'UTR of the PABPC1 to promote the assembly of a translation initiation factor so as to promote the Bcr-Abl translation; knock-down of PABPC1 in an imatinib drug-resistant CML cell line can inhibit Bcr-Abl translation, inhibit cell cycle and proliferation, and promote cell apoptosis; the PABPC1 can obviously regulate and control the stability and translation level of cell cycle related genes, and lays a foundation for screening small molecule drugs by taking the PABPC1 as a diagnosis and treatment target and solving the problems of CML blast crisis and drug resistance.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a target PABPC1 related to diagnosis and treatment of leukemia and its application. Background technique [0002] PABPC1 (poly(A)binding protein cytoplasmic 1) is an RNA-binding protein that is mainly distributed in the cytoplasm and can shuttle between the cytoplasm and the nucleus; PABPC1 contains 4 RRM (RNA recognition domains) and 1 MLLE domain (recognizes the PAM2 domain), through the RRM domain, recognizes AT-enriched RNA sequences. PABPC1 can broadly bind to the PolyA tail of mRNA, maintain the stability of specific mRNA and prevent it from being degraded by nucleases; at the same time, the N-terminus of its RRM2 can broadly bind to the 5'Cap structure of mRNA, and can recruit eIF4G to promote translation initiation complex The formation of eIF4F promotes the recruitment and assembly of ribosome subunits, and promotes mRNA translation. At the same time, PABPC1 can...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/02A61K45/00A61P35/02
CPCC12Q1/6886G01N33/5005A61K45/00A61P35/02C12Q2600/158Y02A50/30
Inventor 余佳马艳妮孙晨光
Owner THE INST OF BASIC MEDICAL SCI OF CHINESE ACAD OF MEDICAL SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More