Bemisia tabaci lethal gene and application thereof, RNA interference agent and preparation method and application of interference agent
A technology of RNA interference and whitefly, applied in the field of genetic engineering, can solve the problems of less whitefly and scarcity of applications, and achieve the effect of reducing viral diseases
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] A whitefly lethal gene, specifically the coding gene Aspartateaminotransferase of aspartate aminotransferase, its gene sequence is shown in SEQ ID NO.1, specifically:
[0037]ATGACCTCTTCGGTTTTCTCCTCCATTGAGCCTGGAATACTGAACGAAATATGCGCATTGCACGAGGAATTTTGCAGCGATCCTTACAGGAAGAAGGTGGATCTTGTTAAAGGAGCTTATCCGACGGACGAAGGAAAACCATGGGTTTTGCCTGTGGTCAGGAAAACTGAAATCATTCTGGCAAACGATGAAAATACCTTTCATGAGTCTGAACATTTTCTGAGCTCCAGCGAGTTTACTGATGCAGCCACTTCCTCACTACTGGGCGAAAAATCCATCGCCGTTCAAGACAAGAGGAAGAGTTTGGGACGCTCACACTTTTACTTATCTGACCCCCATTGGAACGCCTACGAAGTCATAATCATGCAAGCAGGTTTCGAGAAAAGCTCTCGTTACCGATATTGGAATGCGGAGAAACAATGCATTGACATGGATGGACTTTTGGAGGATTTGTCAAAGGCAGAGCCAACTTCGGTCGTTTTACTCCAAGCGTGTGCGCATAACCCGACTGGGTGTGATCCTACCCCCGAACAGTGGGCAAAAATAGCTTCTCTCATGAAGAAAAATAGATTGTTCCCATTCTTCGACATAGCTTATCAAGGTTTGGCGTCTGGTGATATGGACGAAGATGCAGAGGCTGTTCGCTATTTCGTTGACCAGGGTTTCGAGTTACTGTGCGCGCAATCTTTTTCTAAGAACTTTGGTCTTTACGGTGAACGAGTAGGAAGCCTCACTATTGTCTCAAATTGTGCCCATACAATGCCTCATATAGTATCCAAGATGATTAACATCGCTGAGGGCAATTATCTGGT...
Embodiment 2
[0063] A kind of RNA interfering agent of the present invention, dsRNA is synthesized by the Aspartate aminotransferase gene fragment of embodiment 1, and the DNA sequence of RNA interfering agent is as shown in SEQ ID NO.4, is that the target DNA fragment of embodiment 1 is synthesized kit with PROMEGAdsRNA Carrying out the synthesis of dsRNA to obtain the dsRNA containing the Bemisia tabaci lethal gene fragment Aspartateaminotransferase, specifically:
[0064] CGAGUUUACUGAUGCAGCCACUUCCUCACUACUGGGCGAAAAAUCCAUCGCCGUUCAAGACAAGAGGAAGAGUUUGGGACGCUCACACUUUUACUUAUCUGACCCCCAUUGGAACGCCUACGAAGUCAUAAUCAUGCAAGCAGGUUUCGAGAAAAGCUCUCGUUACCGAUAUUGGAAUGCGGAGAAACAAUGCAUUGACAUGGAUGGACUUUUGGAGGAUUUGUCAAAGGCAGAGCCAACUUCGGUCGUUUUACUCCAAGCGUGUGCGCAUAACCCGACUGGGUGUGAUCCUACCCCCGAACAGUGGGCAAAAAUAGCUUCUCUCAUGAAGAAAAAUAGAUUGUUCCCAUUCUUCGACAUAGCUUAUCAAGGUUUGGCGUCUGGUGAUAUGGACGAAGAUGCAGAGGCUGUUCGCUAU。
[0065] Its preparation method comprises the following steps:
[0066] (1) Collect 50-60 Bemisia tabaci...
Embodiment 3
[0086] A kind of RNA interfering agent of embodiment 2 is applied in reducing whitefly gene expression, and its application method comprises the following steps:
[0087] (1) Prepare 15% sucrose solution (water as solvent), fully dissolve, filter with 0.22 μm bacterial filter, and then mix with different volumes of AST dsRNA to obtain 400 ng / μL feeding nutrient solution.
[0088] (2) Add the feeding nutrient solution to the sealing film, and then cover the droplet with the sealing film to remove air bubbles as much as possible to form a pouch containing the feeding nutrient solution. Bemisia tabaci were placed in a glass tube with the pouch containing the feeding nutrient solution facing the light source.
[0089] (3) Put a black cotton plug on it, wrap it with a light-shielding sleeve that can cover the glass tube, and place it in an incubator. The required culture conditions are a light ratio of 14:10 and a humidity of 80%.
[0090] (4) After feeding for 48 h, calculate the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


