Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of glutamate dehydrogenase as target spot in pest control

A technology of glutamate dehydrogenase and pest control, applied in the biological field, can solve the problem of little understanding of the function of silkworm GDH

Active Publication Date: 2022-02-18
SOUTH CHINA NORMAL UNIVERSITY +1
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, little is known about the function of silkworm GDH

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of glutamate dehydrogenase as target spot in pest control
  • Application of glutamate dehydrogenase as target spot in pest control
  • Application of glutamate dehydrogenase as target spot in pest control

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1GDH protein phylogenetic tree construction and protein sequence analysis

[0066] The evolutionary conservation of the homologous sequences of GDH proteins in 11 species was analyzed. These species include Lepidoptera: Bombyx mori (Bombyx mori), Wild silkworm (Bombyx mandarina), Spodoptera litura, Diamondback moth (Plutella xylostella), Cabbage caterpillar (Pieris rapae), Cotton bollworm (Helicoverpa armigera), Golden Phoenix Butterfly (Papilio machaon); Diptera: Drosophila melanogaster; Rodentia: Mus musculus (Mus musculus); Artiodactyla: Wild boar (Sus scrofa); Primates: Homo sapiens. The GDH protein phylogenetic tree was constructed using the ML method (Maximum Likelihood), tested by the bootstrap method (Bootstrap, 1000 replicates), the evolutionary distance was analyzed by Poisson correction, and the data was analyzed by MEGA7. The results of phylogenetic analysis of its protein sequence showed that the evolution was relatively conservative, and Lepidopte...

Embodiment 2

[0067] Example 2 Transgenic CRISPR / Cas9 system to knock out the silkworm glutamate dehydrogenase (GDH) gene

[0068] 1. Selection of target sites

[0069] GDH基因的CDS序列共1665bp,具体序列为:ATGCTGCATCTCAAGAATATCGCCAAGTCAGTGGTTCCGCCGCTCAAGAATTCTGTTCAAAATGAAGCCCTCAATACAATGTTCCGAATCATACCAGCTGGAGTGAATGTCTGCTGCCGCACATACGCTAGTCATGAGATTCCAGATAAGCTCAAAGATATTCCTACAAGTGCGAATCCGAAGTTCTTCCACATGGTAGAATATTTTTTCCACCGAGCCTGTCAAGTTGTCGAAGACAAGCTTGTTGAAGATTTGAAGTCAAGGACACCCATTGAAGAGAAGAAAAAGAAAGTAGCCGGTATTCTAAAACTTATGGAACCATGCGATCACATTCTTGAGATTCAATTTCCTCTGAGGCGCGATTCTGGCGATTACGAAATGATATTAGGCTATCGCGCACAACATTCCACACACAGGACTCCAACCAAAGGAGGTATTCGATTCTCAACGGACGTAACCAGAGATGAAGTTAAGGCGTTATCAGCTTTGATGACCTTCAAGTGCGCGTGCGTGGACGTGCCTTTCGGCGGTGCTAAGGCCGGTATCAAGATCAATCCCAAAGAATACTCCGAGCATGAACTGGAAAAGATCACTCGTCGTTTCACCCTTGAACTTGCCAAAAAAGGATTCATTGGGCCTGGCGTGGATGTCCCCGCTCCTGACATGGGTACCGGCGAACGAGAAATGTCTTGGATCGCCGATACTTATGCGAAGACCGTCGGTTTTCAAGACATCAACGCTCACGCCTGCGTCACTGGCAAACCTATTAACCAGGGTGGCATCCACGGCAGAGTTTCAGCCACGGGCAGGGGC...

Embodiment 3

[0135] Example 3 Phenotype of Bombyx mori GDH Gene Knockout (Knockout by CRISPR / Cas9 System)

[0136] (1) Increased mortality in the larval stage

[0137] Compared with the control group (GDH non-knockout, Wild type), the GDH knockout mutant (△BmGDH) is more susceptible to infection and death in the laboratory environment, such as Figure 7 As shown, the GDH knockout (△BmGDH) worms were more susceptible to viral softening disease than the control group, and the mortality rate in the third instar was as high as 58.9% ( Figure 8 ); Few individuals can survive to the fifth instar and wandering stage, so knocking out GDH in Lepidoptera insects will lead to a large number of larval deaths.

[0138] (2) Larval weight loss

[0139] Compared with the control group (GDH non-knockout, Wild type), the size of the GDH knockout mutant (△BmGDH) gradually increased from the third age ( Figure 9 ), significantly reduced body weight ( Figure 10 ).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology, and discloses application of glutamate dehydrogenase as a target spot in pest control. The invention discloses the application of glutamate dehydrogenase as a target spot in pest control for the first time, GDH is knocked out through target gene screening in combination with a CRISPR / Cas9 technology, and the importance of glutamate dehydrogenase to growth and development of pests is proved. GDH gene mutants are successfully obtained in pests by utilizing a transgenic CRISPR / Cas9 technology, GDH gene mutation seriously affects normal growth and development of the pests, individuals become small, and the pests are prone to being infected with viruses in a larval stage and die, and massive death caused by GDH gene mutation in the larval stage can be used for pest control.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the application of glutamic acid dehydrogenase as a target in pest control. Background technique [0002] Insects are one of the most diverse and numerous biological groups in the animal kingdom, consisting of 35 orders. Lepidoptera is the second largest order of insects, including not only the silkworm (Bombyx mori), an important economic insect, but also cotton bollworm (Helicoverpaarmigera), litura litura (Spodoptera litura), diamondback moth (Plutella xylostella) and pine caterpillar (Dendrolimus punctatus) and other agricultural and forestry pests. For these pests, the traditional control measures based on chemical pesticides have caused serious harm to the environment and other organisms while killing the pests, and long-term use of pesticides will also produce drug resistance. It is very necessary to have a means to effectively prevent and control lepidopteran pe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/85C12N15/55C12N15/53
CPCC12N15/1137C12N15/85C12N9/22C12N9/0016C12N2310/20C12N2800/105C12Y104/01002
Inventor 衣玫妍杨煦刘祖莲黄勇平相辉
Owner SOUTH CHINA NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com