Application of CRIP2 in detecting drug resistance of prostate cancer to docetaxel and reversing drug resistance of prostate cancer to docetaxel
A technology for docetaxel and prostate cancer, applied in the field of medicine and biology, can solve the problems of acquired drug resistance of docetaxel, and achieve the effects of reversing the drug resistance of prostate cancer, inhibiting growth and improving sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Example 1: Research on the expression of CRIP2 gene / protein in prostate cancer cells and prostate cancer drug-resistant cells
[0052] 1. Cell culture:
[0053] Prostate cancer cell line DU145 was purchased from Wuhan Punuosheng Life Science and Technology Co., Ltd.; DTX-resistant prostate cancer cell line DU145 (referred to as DU145 / DTXR cells) was induced by our laboratory (currently preserved in our laboratory and available to the public, The public can obtain DU145 / DTXR cells by purchasing). Prostate cancer cell line DU145 and DTX-resistant prostate cancer cell line DU145 were both used in 1640 medium containing 10% fetal bovine serum in 5% CO 2 1. Cultivate in a 37°C constant temperature cell incubator, wherein DTX drug-resistant prostate cancer cell culture medium is added with corresponding concentration of DTX.
[0054] Construction method of DTX-resistant prostate cancer cell line DU145 / DTXR:
[0055] In the present invention, human prostate cancer cell line...
Embodiment 2
[0114] Example 2: Construction of a cell line that stably interferes with CRIP2 in DU145 / DTX drug-resistant cells
[0115] 1. Cell culture:
[0116] The specific operation of cell culture is the same as that of Example 1, and will not be repeated here.
[0117] 2. shRNA design
[0118] The viral vector provided by Beijing Qingke Biotechnology Co., Ltd. was selected for transfection. The name of the shRNA lentiviral vector of the CRIP2 gene is:
[0119] Negative control shRNA (referred to as sh-NC) sequence: GGGCAAGACGAGCGGGAAG;
[0120] The sequence of shRNA 1: GCAAGCCCAGGGCGAGTATTG (shown in SEQ ID NO.3);
[0121] The sequence of shRNA 2: GGGCGTCCCATGATCCCTTCT (shown in SEQ ID NO.4).
[0122] 3. Stable transfection of cells:
[0123] Cells were transfected according to the instructions of the transfection reagent Lipofectamine 3000 Reagent (Invitrogen). Specific steps are as follows:
[0124] (1) Inoculate 293T cells into T25 culture flasks, incubate at 37°C, 5% CO 2 ...
Embodiment 3
[0153] Example 3: Changes in the sensitivity of DTX-resistant prostate cancer cells to DTX after stably interfering with CRIP2
[0154] The IC50 value (half lethal concentration) of DTX on prostate cancer cells before and after interfering with CRIP2 was compared by CCK8 method.
[0155] 1. Cell culture:
[0156] The cells used in this experiment were DU145 / DTXR cells stably transfected with sh-NC (denoted as sh-NC), DU145 / DTXR cells stably transfected with shRNA 1 (denoted as sh-CRIP2#1) and stably transfected with shRNA 2 DU145 / DTXR cells (referred to as sh-CRIP2#2).
[0157] The specific operation of cell culture is the same as that of Example 1, and will not be repeated here.
[0158] 2. Experimental method
[0159] (1) The experiment was divided into 3 groups, which were negative control group (sh-NC group), sh-CRIP2#1 group, and sh-CRIP2#2 group. Each group was set with 10 DTX concentration gradients, and the 10 concentration gradients were 200nM, 100nM, 50nM, 25nM, ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


