Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of CRIP2 in detecting drug resistance of prostate cancer to docetaxel and reversing drug resistance of prostate cancer to docetaxel

A technology for docetaxel and prostate cancer, applied in the field of medicine and biology, can solve the problems of acquired drug resistance of docetaxel, and achieve the effects of reversing the drug resistance of prostate cancer, inhibiting growth and improving sensitivity

Active Publication Date: 2022-03-11
PEOPLES HOSPITAL OF HENAN PROV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, after docetaxel treatment, up to 95% of patients will develop docetaxel acquired drug resistance

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of CRIP2 in detecting drug resistance of prostate cancer to docetaxel and reversing drug resistance of prostate cancer to docetaxel
  • Application of CRIP2 in detecting drug resistance of prostate cancer to docetaxel and reversing drug resistance of prostate cancer to docetaxel
  • Application of CRIP2 in detecting drug resistance of prostate cancer to docetaxel and reversing drug resistance of prostate cancer to docetaxel

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1: Research on the expression of CRIP2 gene / protein in prostate cancer cells and prostate cancer drug-resistant cells

[0052] 1. Cell culture:

[0053] Prostate cancer cell line DU145 was purchased from Wuhan Punuosheng Life Science and Technology Co., Ltd.; DTX-resistant prostate cancer cell line DU145 (referred to as DU145 / DTXR cells) was induced by our laboratory (currently preserved in our laboratory and available to the public, The public can obtain DU145 / DTXR cells by purchasing). Prostate cancer cell line DU145 and DTX-resistant prostate cancer cell line DU145 were both used in 1640 medium containing 10% fetal bovine serum in 5% CO 2 1. Cultivate in a 37°C constant temperature cell incubator, wherein DTX drug-resistant prostate cancer cell culture medium is added with corresponding concentration of DTX.

[0054] Construction method of DTX-resistant prostate cancer cell line DU145 / DTXR:

[0055] In the present invention, human prostate cancer cell line...

Embodiment 2

[0114] Example 2: Construction of a cell line that stably interferes with CRIP2 in DU145 / DTX drug-resistant cells

[0115] 1. Cell culture:

[0116] The specific operation of cell culture is the same as that of Example 1, and will not be repeated here.

[0117] 2. shRNA design

[0118] The viral vector provided by Beijing Qingke Biotechnology Co., Ltd. was selected for transfection. The name of the shRNA lentiviral vector of the CRIP2 gene is:

[0119] Negative control shRNA (referred to as sh-NC) sequence: GGGCAAGACGAGCGGGAAG;

[0120] The sequence of shRNA 1: GCAAGCCCAGGGCGAGTATTG (shown in SEQ ID NO.3);

[0121] The sequence of shRNA 2: GGGCGTCCCATGATCCCTTCT (shown in SEQ ID NO.4).

[0122] 3. Stable transfection of cells:

[0123] Cells were transfected according to the instructions of the transfection reagent Lipofectamine 3000 Reagent (Invitrogen). Specific steps are as follows:

[0124] (1) Inoculate 293T cells into T25 culture flasks, incubate at 37°C, 5% CO 2 ...

Embodiment 3

[0153] Example 3: Changes in the sensitivity of DTX-resistant prostate cancer cells to DTX after stably interfering with CRIP2

[0154] The IC50 value (half lethal concentration) of DTX on prostate cancer cells before and after interfering with CRIP2 was compared by CCK8 method.

[0155] 1. Cell culture:

[0156] The cells used in this experiment were DU145 / DTXR cells stably transfected with sh-NC (denoted as sh-NC), DU145 / DTXR cells stably transfected with shRNA 1 (denoted as sh-CRIP2#1) and stably transfected with shRNA 2 DU145 / DTXR cells (referred to as sh-CRIP2#2).

[0157] The specific operation of cell culture is the same as that of Example 1, and will not be repeated here.

[0158] 2. Experimental method

[0159] (1) The experiment was divided into 3 groups, which were negative control group (sh-NC group), sh-CRIP2#1 group, and sh-CRIP2#2 group. Each group was set with 10 DTX concentration gradients, and the 10 concentration gradients were 200nM, 100nM, 50nM, 25nM, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of medical biology, and discloses a molecular marker capable of being used for detecting drug resistance of prostatic cancer to docetaxel, and the molecular marker is CRIP2 gene or CRIP2 protein; the expression quantity of the CRIP2 gene or the CRIP2 protein in the DTX drug-resistant prostate cancer cells is obviously higher than that of normal prostate cancer cells, and the difference has statistical significance, so that the expression quantity of the CRIP2 gene or the CRIP2 protein can be used as one of the bases for judging the drug resistance / sensitivity of a drug user to the DTX drug. Moreover, by knocking down the expression level of the CRIP2 gene in the DTX drug-resistant prostate cancer cells, the sensitivity of the DTX drug-resistant prostate cancer cells to DTX can be improved, and meanwhile, the proliferation of the DTX drug-resistant prostate cancer cells can be obviously inhibited after the CRIP2 gene is interfered, so that the CRIP2 gene can be used as an action target for reversing the DTX drug resistance of the prostate cancer, and can be used for preparing drugs for treating the DTX drug resistance of the prostate cancer. The drug resistance of tumor cells to docetaxel can be reversed by inhibiting the expression and / or function of the CRIP2 gene, and important significance is achieved for prostatic cancer treatment.

Description

technical field [0001] The invention belongs to the technical field of medicine and biology, and specifically relates to the application of CRIP2 gene in detecting the resistance of prostate cancer to docetaxel and reversing the resistance of prostate cancer to docetaxel. Background technique [0002] Prostate cancer (PC) is the most common malignancy in men and the second leading cause of cancer-related death in men worldwide. The early stage of prostate cancer is often asymptomatic, and there is a lack of simple, effective and specific screening methods, which makes early diagnosis of prostate cancer difficult. Most patients are already in the middle and late stages when they are diagnosed, so treatment is more difficult. Androgen deprivation therapy is still the basic treatment for metastatic prostate cancer, advanced carcinoma in situ, and hormone-sensitive prostate cancer. Recent studies have found that for castration-resistant prostate cancer patients, the use of doce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886G01N33/68A61K45/06A61K31/713A61K31/337A61P35/00
CPCC12Q1/6886G01N33/68A61K45/06A61K31/713A61K31/337A61P35/00C12Q2600/106C12Q2600/158G01N2800/7028G01N2800/52G01N2333/47A61K2300/00Y02A50/30
Inventor 刘莉娜李梦园张钧硕万明会李祥张晖徐登飞郭燕仓顺东
Owner PEOPLES HOSPITAL OF HENAN PROV