Bispecific antibodies and uses thereof

An antibody, recombinant antibody technology, applied in the direction of antibodies, specific peptides, antiviral agents, etc., can solve problems such as NK cell depletion, achieve significant tumor or viral infection, significant anti-tumor and anti-viral capabilities, treatment or prevention of tumors or Effects of viral infection

Pending Publication Date: 2022-04-01
SHANGHAI NK CELLTECH CO LTD
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

NK cells express many activating receptors, which can effectively recognize the stress ligands produced by tumor cells or infected cells, thereby effectively killing tumor cells, but at the same time, tumor cells also sec...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bispecific antibodies and uses thereof
  • Bispecific antibodies and uses thereof
  • Bispecific antibodies and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0085] Example 1 Design and construction of bispecific antibody molecule anti-CD16a-FCγ4-IL21

[0086] The specific experimental operation of this embodiment is as follows:

[0087] 1.1 Acquisition of anti-CD16a-FCγ4-IL21 fusion gene

[0088] (1) Acquisition of Anti-CD16a-FCγ4 fusion gene

[0089] Using the Pgapza-CD16-FC4γ4 plasmid as a template, use primer 1 and primer 2 to carry out PCR to obtain the anti-CD16a-FCγ4 fusion gene, which has the nucleotide sequence shown in SEQ ID NO:6, and the PCR program is: denaturation: 9820s ; Cycle: 98 10s → 54 15s → 7240s (30 cycles) extension: 72 2min;

[0090] CAAGTTCAATTGGTTCAATCTGGTGCTGAGGTTAAGAAACCAGGTGAGTCTTTGAAGGTTTCTTGTAAGGCTTCTGGTTATACTTTCACTTCTTACTATATGCATTGGGTTAGACAAGCTCCAGGTCAAGGTTTGGAGTGGATGGGTATTATTAATCCATCTGGTGGTTCTACTTCTTATGCTCAAAAGTTCCAAGGTAGAGTTACTATGACTAGAGATACTTCTACTTCTACTGTTTATATGGAGTTGTCTTCTTTGAGATCTGAAGATACTGCTGTTTATTATTGTGCTAGAGGTTCTGCTTATTATTATGATTTCGCTGATTATTGGGGTCAAGGTACTTTGGTTACTGTCTCTTCTGGTGGTGGTGGTTCTGGTG...

Embodiment 2

[0103] Example 2 Expression and purification of bispecific antibody molecule anti-CD16a-FCγ4-IL21

[0104] 2.1 Expression of anti-CD16a-FCγ4-IL21 bispecific antibody molecule

[0105] The positive clone constructed in Example 1 was expanded and cultivated in 50 mL LZ liquid medium, and the plasmid PGAP-zα-anti-CD16a-FCγ4-IL21 was extracted in a large amount using a kit (Axygen Company). The expression plasmid PGAP-zα-anti-CD16a-FCγ4-IL21 prepared in the previous step was linearized with endonuclease SpeI and recovered by ethanol precipitation. Ethanol precipitation steps: 1) Add twice the volume of absolute ethanol and 0.1 times the volume of 3M sodium acetate to the enzyme digestion reaction system, and precipitate at -20°C for more than 2 hours. 2) Centrifuge at 12000 g for 10 minutes, discard the supernatant. 3) The pellet was resuspended in 300 μL of 70% ethanol, centrifuged at 12000 g for 10 minutes, and the supernatant was discarded. 4) Dry at 37°C, resuspend in deion...

Embodiment 3

[0121] Example 3 Verification of the bispecific antibody anti-CD16a-FCγ4-IL21 inducing NK cell activation in vitro

[0122] Human PBMCs were isolated by Ficoll density gradient centrifugation. Dilute the isolated PBMC to 1.0×10 with RPMI1640 containing 10% FBS 6 / mL. Add 10 mL of diluted cells to the T25 culture flask. After culturing for 12 hours, anti-CD16a-FCγ4-IL21 fusion protein was added to the culture flask at a final concentration of 20 nM. After 24 hours of culture, flow cytometry was used to detect the phenotype changes of NK cells, mainly to detect the expression of main activating molecules CD69, NKp44 and killing molecules 4-1BB, TRAIL, and Granzyme B on the surface of NK cells.

[0123] The specific experimental results are as Figure 6 As shown, compared with the control group PBS (Control group), in the experimental group added with anti-CD16a-FCγ4-IL21 fusion protein, the main activating molecules CD69, NKp44 and killing molecules 4-1BB, TRAIL, The expres...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention provides a bispecific antibody and an application thereof. The bispecific antibody comprises an IL-21 molecule, an IL-21 molecule and a bispecific antibody, the antibody comprises a CD16a single-chain antibody and an FC, the N tail end of the FC is connected with the C tail end of the single-chain antibody, and the CD16a single-chain antibody comprises a heavy chain variable region and a light chain variable region; and the C terminal of the FC is connected with the N terminal of the IL21 molecule. The bispecific antibody prepared by the invention can target CD16 and IL-21 receptors at the same time and activate NK cells, has a long half-life period, shows stronger anti-tumor and anti-virus capacities compared with a single-target antibody, and has application potentials of promoting NK cell proliferation and being used for in-vitro culture and amplification of NK cells, and the amplified NK cells have good cytotoxicity.

Description

technical field [0001] The present invention belongs to the field of biomedicine, specifically relates to bispecific antibodies and applications thereof, and more specifically relates to recombinant antibodies, immune cells, nucleic acids, expression vectors, recombinant cells, compositions, the use of the above substances in the preparation of medicines, Reagent test kit. Background technique [0002] Bispecific antibodies are antibodies that can specifically bind two antigenic sites at the same time. NK cells are the main effector cells of the innate immune system. Compared with T cells, NK cells can kill tumor cells and virus-infected cells without MHC restriction by using perforin, granzyme and related mechanisms without prior stimulation. NK cells express many activating receptors, which can effectively recognize the stress ligands produced by tumor cells or infected cells, thereby effectively killing tumor cells, but at the same time, tumor cells also secrete and prod...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C07K19/00C12N15/62C12N15/81C12N5/10A61K39/44A61K38/20A61K47/68A61P35/00A61P31/20A61P31/16A61P31/14G01N33/68
CPCA61K38/20A61K39/395A61K39/44A61K47/68A61P31/14A61P31/16A61P35/00A61P31/20C07K16/00C07K16/30C07K16/46C07K19/00C12N5/10C12N15/62C12N15/81G01N33/68
Inventor 肖卫华田志刚李洋阳谢思奇陈敏华
Owner SHANGHAI NK CELLTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap