Unlock instant, AI-driven research and patent intelligence for your innovation.

Microglia-like cell line containing TREM2 mutant gene, mouse model and construction method thereof

A technology of microglia and mutated genes, applied in the field of genetic engineering, can solve problems such as the difficulty of in-depth exploration of the role of TREM2

Pending Publication Date: 2022-04-01
XUANWU HOSPITAL OF CAPITAL UNIV OF MEDICAL SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This further reveals that microglia may play an important role in the development of AD, but it is still difficult to deeply explore the role of TREM2 in AD

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microglia-like cell line containing TREM2 mutant gene, mouse model and construction method thereof
  • Microglia-like cell line containing TREM2 mutant gene, mouse model and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Materials: skin tissue cells containing the TREM2 mutant gene whose nucleotide sequence is shown in the sequence table SEQ ID No.1, and skin tissue cells containing the normal TREM2 gene.

[0030] Such as figure 1 As shown, this embodiment provides a method for constructing a microglia-like cell line containing a TREM2 mutant gene, including the following steps.

[0031] S1: Epidermal cells are induced to differentiate into pluripotent stem cells (induced pluripotent stem cells, hereinafter referred to as iPSCs)

[0032] The skin tissue cells containing the nucleotide sequence such as the TREM2 mutant gene shown in the sequence table SEQ ID No.1, and the skin tissue cells containing the normal TREM2 gene were respectively included in four transcription factors Oct4, Klf4, Sox2 and c-Myc Cells with pluripotency similar to the biological characteristics of embryonic stem cells are induced, namely iPSCs.

[0033] S2: iPSC differentiated into early primitive hematopoietic...

Embodiment 2

[0045] This embodiment provides a method for constructing a mouse model containing a TREM2 mutant gene, including the following steps.

[0046] S1: Preparation of sgRNA

[0047] 1. Design and synthesis of sgRNA: Using mouse TREM2 genome information, design and synthesize gRNA single-stranded sequences used in the CRISPR system.

[0048] TREM2 gRNA2 F: TAGG TGCACAAGGTCCCCTCCGGC (SEQ ID No. 3).

[0049] TREM2 gRNA2 R: AAAC GCCGGAGGGGACCTTGTGCA (SEQ ID No. 4).

[0050] 2. Annealing and renaturation of single-stranded oligonucleotides.

[0051] 3. Construction of pUC57-sgRNA plasmid, including the following steps: 1) Ligation of pUC gRNA plasmid, adding water to 20 μL, incubating at 37°C for 2 hours, shaking occasionally. 2) Purify the digested product with a PCR purification kit. 3) Ligate the annealed oligomers with bsai-digested pUC57-sgRNA. 4) Transformation and plating on Kan+ plates (50 g / mL). 5) M13-47 primer was sequenced to confirm that the sgRNA oligomer was insert...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a microglia-like cell line containing a TREM2 mutant gene, a mouse model and a construction method of the microglia-like cell line. The construction method of the microglia-like cell line containing the TREM2 mutant gene comprises the following steps: taking skin tissue cells containing the TREM2 mutant gene of which the nucleotide sequence is as shown in SEQ ID No.1 in a sequence table, culturing by using a transcription factor, and inducing to obtain pluripotent stem cells; then differentiating into early-stage original hematopoietic cells; and then differentiating into a microglia-like cell line. The mouse model containing the TREM2 mutant gene is constructed by adopting a CRISPR / Cas9 system, and the method comprises the following steps: micro-injecting single-stranded oligonucleotide containing Cas9 mRNA, sgRNA and the TREM2 mutant gene into a mouse fertilized egg, then transplanting the fertilized egg into a mouse fallopian tube for inoculation, and the born mouse is the mouse model containing the TREM2 mutant gene. The microglia-like cell line provided by the invention is convenient for in-vitro research on the reason of the action of TREM2 in the AD pathological process through microglia-like cells, and the establishment of the mouse model is convenient for in-vivo research on the action mechanism of TREM2 mutation on the AD pathological process.

Description

technical field [0001] The application belongs to the technical field of genetic engineering, and in particular relates to a microglia-like cell line containing a TREM2 mutant gene, a mouse model and a construction method thereof. Background technique [0002] Alzheimer's disease (AD) is a major neurodegenerative disease affecting human health, and its typical performance is the slow progressive loss of cognitive function. Because its onset is closely related to age, and it mostly occurs in the elderly; therefore, with the aging of the social population, the incidence rate will become higher and higher. There are 2047 AD patients for every 8 million population in the United States, and there are 6-10 million AD patients in China. However, so far humans have no effective measures to treat the disease. [0003] The study found that the genetic variation of APP, PSEN1, PSEN2 and the genotyping of APOE have a great relationship with the occurrence of AD. In recent years, thro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N5/079C12N5/0789C12N5/071C12N15/89C12N15/55C12N15/113A01K67/027C12R1/91
Inventor 唐毅秦琪韦玉生李沉简
Owner XUANWU HOSPITAL OF CAPITAL UNIV OF MEDICAL SCI