A method for constructing a microglia potassium ion probe transgenic mouse model
A technology of transgenic mice and microglia, applied in the field of biomedicine, can solve problems such as inability to study and obstacles to disease research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] A method for constructing a microglia potassium probe transgenic mouse (Cx3cr1 site-directed gene knock-in GINKO1-P2A-tdTomato-T2A) model, the gene information of which is shown in Table 1 below.
[0029] Table 1 Knock-in gene sequence information
[0030]
[0031] Its construction strategy is figure 1 shown, including the following steps:
[0032] (1) Construction of specific gRNA targeting the Cx3cr1 gene in vitro: According to the mouse Cx3cr1 gene sequence, use the Cas-Designer software to design the gRNA target sequence, and search the mouse gene in the DBM-DB genome database, using the CRISPR off-target effect software Cas- OFFinder detects potential off-target sites; the designed gRNA sequence is shown in SEQ ID NO: 1 (5'-3': TAGATCCAGTTCAGGGAAGG, PAM: AGG).
[0033] (2) Construct a homologous recombination vector (Donorvector) of Cx3cr1 site-directed gene knock-in GINKO1-P2A-tdTomato-T2A. The specific steps are as follows: The GINKO1-P2A-tdTomato-T2A gene e...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


