Unlock instant, AI-driven research and patent intelligence for your innovation.

A method for constructing a microglia potassium ion probe transgenic mouse model

A technology of transgenic mice and microglia, applied in the field of biomedicine, can solve problems such as inability to study and obstacles to disease research

Active Publication Date: 2022-06-21
JINAN UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the existing research, there are no relevant animal or cell models related to microglia, which makes the research of diseases related to it a big obstacle, and it is impossible to directly study through the disease model.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for constructing a microglia potassium ion probe transgenic mouse model
  • A method for constructing a microglia potassium ion probe transgenic mouse model
  • A method for constructing a microglia potassium ion probe transgenic mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] A method for constructing a microglia potassium probe transgenic mouse (Cx3cr1 site-directed gene knock-in GINKO1-P2A-tdTomato-T2A) model, the gene information of which is shown in Table 1 below.

[0029] Table 1 Knock-in gene sequence information

[0030]

[0031] Its construction strategy is figure 1 shown, including the following steps:

[0032] (1) Construction of specific gRNA targeting the Cx3cr1 gene in vitro: According to the mouse Cx3cr1 gene sequence, use the Cas-Designer software to design the gRNA target sequence, and search the mouse gene in the DBM-DB genome database, using the CRISPR off-target effect software Cas- OFFinder detects potential off-target sites; the designed gRNA sequence is shown in SEQ ID NO: 1 (5'-3': TAGATCCAGTTCAGGGAAGG, PAM: AGG).

[0033] (2) Construct a homologous recombination vector (Donorvector) of Cx3cr1 site-directed gene knock-in GINKO1-P2A-tdTomato-T2A. The specific steps are as follows: The GINKO1-P2A-tdTomato-T2A gene e...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for constructing a microglia potassium ion probe transgenic mouse. The present invention constructs a microglial cell potassium ion probe transgenic mouse model, and expresses the potassium ion green fluorescent probe GINKO1 in microglial cells through the promoter of the microglial cell-specific Cx3cr1 gene, which can interact with intracellular The combination of potassium ions shows a green fluorescent signal, which finally reflects the change of potassium ion concentration, so as to realize the real-time observation of the dynamic changes of potassium ions in microglia and macrophages in the living mouse brain. The present invention has great significance for the research of diseases related to microglia and macrophages, such as neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease and stroke. In addition, it also greatly promoted the biological research of microglia and macrophages, and laid a solid theoretical research foundation for the establishment of subsequent related disease models and clinical research.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and relates to a construction method and application of a microglia potassium ion probe transgenic mouse model. Background technique [0002] As resident immune cells of the nervous system, microglia play an unusually important role in health and disease. Real-time dynamic monitoring of brain microglial activity has always been a technical problem in the field of brain science. When microglia are exercising their activities, intracellular potassium ions play the role of messengers, so studying the changes in microglia activities can be done by observing the changes in intracellular potassium ions. However, in the existing research, there is no relevant animal or cell model related to microglia, which makes the related disease research a big obstacle, and it cannot be directly studied through the disease model. SUMMARY OF THE INVENTION [0003] The purpose of the present invention is to so...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/85C12N15/90C12N15/65C12N15/12C12N15/113A01K67/027C12Q1/6888C12N15/11
Inventor 杨英韩建邦赵铮何妞丁燕李晨
Owner JINAN UNIVERSITY