Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Antisense oligonucleotide of METTL3 and application of antisense oligonucleotide in prostate cancer

An antisense oligonucleotide and prostate cancer technology, applied in the field of antisense oligonucleotide and its application in prostate cancer, can solve the problems that oligonucleotide drugs have not been reported, research has not been reported, etc. Achieve the effect of recovery sensitivity and high knockout efficiency

Pending Publication Date: 2022-05-06
天津市泌尿外科研究所
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Although there have been many studies on the mechanism of METTL3 as an oncogene, the research on its mediation of cell resistance to enzalutamide in prostate cancer has not been reported, and there are no studies on oligonucleotide drugs targeting METTL3. to report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antisense oligonucleotide of METTL3 and application of antisense oligonucleotide in prostate cancer
  • Antisense oligonucleotide of METTL3 and application of antisense oligonucleotide in prostate cancer
  • Antisense oligonucleotide of METTL3 and application of antisense oligonucleotide in prostate cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0127] Example 1 Effect of METTL3 on castration-resistant prostate cancer cell line C4-2 and LNCap-AI on enzalutamide resistance

[0128] Use lentivirus to transfect the vector carrying the sh-METTL3 sequence and puromycin resistance gene, based on LNCAP-AI and C4-2 cell lines, after transfecting the virus, culture the cells for one week, and use puromycin to screen to obtain METTL3 knockdown stable cell line.

[0129]The control cells and knockdown cells were plated in 96-well plates (n=5) and 6-well plates, respectively, with 2000 cells per well, and enzalutamide and DMSO were administered, respectively.

[0130] For 96-well plates, place at 37°C, 5% CO 2 Culture in an incubator, and take out a 96-well plate every 24 hours. Use PBS solution or normal saline as a solvent, and prepare a tetramethylazoazole (MTT) solution with a final concentration of 5 mg / ml. Add 10 μl of MTT solution to each well, and place again at 37°C, 5% CO 2 Incubate for 2 hours in the incubator. Tw...

Embodiment 2

[0133] Example 2 Expression of METTL3 in drug-resistant castration-resistant prostate cancer cell lines

[0134] 1. Construction of enzalutamide-resistant castration-resistant prostate cancer cell lines

[0135] Prostate cancer cell line C4-2 was cultured in RPMI-1640 medium with 10% fetal bovine serum, and different concentrations of enzalutamide (5 μM, 10 μM, 20 μM, 40 μM) were gradually added to the medium. Cells were cultured in a cell incubator at 37°C, 5% CO 2 . During the culture process, it is determined whether to perform cell replacement and cell passage according to the actual growth of the cells. When the cells are cultured to 40 μM enzalutamide, the growth and proliferation rate is the same as that of the primary C4-2 in 10% fetal bovine serum RPMI- The 1640 medium is roughly the same.

[0136] Using a microscope to observe the drug-resistant cells and the original cells can be seen to have significant morphological differences ( figure 2 ).

[0137] 2. MTT ...

Embodiment 3

[0142] Design and detection of the antisense oligonucleotide of embodiment 3METTL3

[0143] 1. Biological identification of ASO sequences and comparison of modification schemes and sites

[0144] Use the BLAST biological serial information primary structure online comparison tool in NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) to compare and analyze the mRNA structure information of each transcript of Mettl3 mRNA, and record it consensus sequence. Use the "soligo" page (http: / / sfold.wadsworth.org / cgi-bin / index.pl) in the sfold RNA secondary structure online prediction tool to input the consensus sequence of each transcript of Mettl3, and select the oligo length as 20nt. Submit and record screening results.

[0145] All ASO sequences (Table 1) were purchased from the company (Sangko Sagon) and only basic modifications were used (Table 2).

[0146] Table 1 ASO sequence

[0147] ASO sequence serial number GGTGTAGCAACTTCTTTCTCT SEQ ID NO.1 TCTTTTCTGC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an antisense oligonucleotide of METTL3 and an application of the antisense oligonucleotide in prostatic cancer. By inhibiting the expression level of METTL3, proliferation of castration-resistant prostate cancer cells can be reduced, the drug sensitivity of drug-resistant prostate cancer cell strains can be recovered, and a new means is provided for treating castration-resistant prostate cancer and drug-resistant prostate cancer.

Description

technical field [0001] The invention belongs to the field of biomedicine and relates to an antisense oligonucleotide targeting METTL3 and its application in prostate cancer. Background technique [0002] As a malignant tumor with the second mortality rate in the world, prostate cancer has attracted the attention of clinicians at home and abroad (Ferlay J, Soerjomataram I, Dikshit R, et al. Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012[J ]. Int J Cancer, 2015, 136(5): E359-86.). There are obvious regional differences in the incidence of prostate cancer, and the incidence in the West is about 25 times that in Asia, which may be related to factors such as the low screening rate of PSA in Asian countries (Ha Chung B, Horie S, Chiong E. The incidence , mortality, and risk factors of prostate cancer in Asianmen [J]. Prostate Int, 2019, 7(1):1-8.). However, due to factors such as population aging, the incidence of prostate cancer i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N9/10C12Q1/6886C12N15/11G01N33/574G01N33/68A61K45/06A61K31/7088A61K31/4166A61P35/00
CPCC12N15/1137C12N9/1007C12Q1/6886G01N33/57434G01N33/68A61K45/06A61K31/7088A61K31/4166A61P35/00C12N2310/11C12N2310/315C12N2310/32C12Q2600/136C12Q2600/106C12Q2600/158G01N2333/91011A61K2300/00
Inventor 尚芝群牛远杰李阳陈昱彤
Owner 天津市泌尿外科研究所
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com