Supercharge Your Innovation With Domain-Expert AI Agents!

Detection of substances in aspirin's snp sites with protective effect on cardiovascular and cerebrovascular diseases and its application

A technology for cardiovascular and cerebrovascular diseases, aspirin, applied in the direction of recombinant DNA technology, biochemical equipment and methods, microbial measurement/testing, etc., can solve problems such as AR genetics diagnosis and monitoring that are not suitable for Chinese populations, and achieve accurate Prevention and health management throughout the whole process, and the effect of reducing the probability of occurrence

Active Publication Date: 2022-06-28
SECOND MEDICAL CENT OF CHINESE PLA GENERAL HOSPITAL
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, most of the data on AR-associated SNPs come from European races, which are not suitable for the diagnosis and monitoring of AR genetics in Chinese races

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection of substances in aspirin's snp sites with protective effect on cardiovascular and cerebrovascular diseases and its application
  • Detection of substances in aspirin's snp sites with protective effect on cardiovascular and cerebrovascular diseases and its application
  • Detection of substances in aspirin's snp sites with protective effect on cardiovascular and cerebrovascular diseases and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 The primers and kits of the present invention used to detect the SNP site rs10306190 (966C>G) of the 3'-UTR of the COX-1 gene

[0030] (1) Name and structure of DNA sequence: COX-1 gene, also known as prostaglandin synthase-1 gene

[0031](prostaglandin synthetase1, PTGS1), Gene ID 5742. Located at 9q32-q33.3, chr9:122,371,024-122,395,703, the upstream 5'-untranslated region (UTR) totals 1862 bp; the downstream untranscribed 3'-UTR totals 3157 bp, the full length is 24,680 bp, consisting of 11 Consists of 10 exons and 10 introns, the COX-1 gene promoter region lacks TATA box, rich in GC region, and performs housekeeping gene function in vivo. 其中rs10306190(966C>G)位点位于3'-UTR ,rs1030619序列信息如SEQ ID No.1所示:SEQ IDNo.1:gactttctgctgggatccttgggcccatcactgtatagacatgctaccactggtacttcctttctccctgcgggccaggcactgcccttttcaggaakct[c / g]tcttaaaatacccattgccccagacctggaagatataacattcagttcccaccatctgattaaaacarcttcctcccttacagagcatacaacagagggg。

[0032] (2) Design multiple PCR primers for...

Embodiment 2

[0042] Example 2 The method for detecting the rs10306190 genotype of COX-1 gene using the primer set and the kit of the present invention

[0043] (1) DNA extraction:

[0044] DNA samples are derived from human leukocytes. 2ml of peripheral venous blood was collected from the patient and placed in an anticoagulation tube. Using the whole genome DNA extraction kit (product of Beijing Tiangen Biochemical Co., Ltd.), according to the instructions, leukocyte genomic DNA was extracted from 1ml peripheral blood, and dissolved in 0.1×TE buffer (10mmol / L Tris-1mmol / LEDTA, pH8.0 ) and stored in a -20°C refrigerator for later use.

[0045] (2) COX-1 genotyping using Fluidigm's nanoscale microfluidics technology:

[0046] In this study, we used the BioMark HD microfluidic chip gene analysis system in our laboratory and purchased a Fluidigm 96×96 genotyping chip (Dynamic Array Chip for Genotyping) to type candidate marker loci. The experimental process is as follows: pre-amplify the s...

Embodiment 3

[0067] Example 3 Association analysis of rs10306190 of COX-1 gene and long-term cardiovascular events in patients taking aspirin

[0068] (1) The best implementation crowd of the present invention:

[0069] Chinese Han population who regularly take the antiplatelet drug aspirin 75mg-100mg / d for secondary prevention in patients with ischemic cardiovascular and cerebrovascular diseases.

[0070] (2) General information of the patients of the embodiment:

[0071] The included cases involved in the present invention were from April 2008 to July 2010, from the military cadre rest center in Beijing, and took the antiplatelet drug aspirin 75mg-100mg / d regularly and throughout the course of the secondary prevention of ischemic cardiovascular and cerebrovascular disease patients 486 There were 334 males (68.7%) and 152 females (31.3%). The average age was 73.86±8.15 (48-92) years old. The remaining features are shown in Table 6.

[0072] (4) Method

[0073] ① Design of multiplex P...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of a substance for detecting the polymorphism or genotype of rs10306190 of the COX‑1 gene in the human genome in the preparation and detection of products that aspirin has a protective effect on the occurrence of cardiovascular events in patients with cardiovascular and cerebrovascular diseases; the COX‑1 The rs10306190 genotype of the 1 gene is CC, CG or GG, wherein the individuals of the GG genotype have a higher protective effect on ischemic cardiovascular and cerebrovascular diseases than individuals of other genotypes after taking aspirin. The invention provides a detection primer and a detection kit that can accurately evaluate the prognosis of ischemic cardiovascular and cerebrovascular diseases treated with aspirin. The present invention provides a new idea and method for expanding the clinical application of aspirin, and realizes precise prevention and treatment of ischemic cardiovascular and cerebrovascular diseases and whole-process health management to a certain extent.

Description

technical field [0001] The present invention relates to a substance for detecting SNP sites, in particular to a substance for detecting polymorphism or genotype of rs10306190 of COX-1 gene in human genome and its preparation, detection and administration of aspirin to prevent and treat deficiency Application of SNP loci that benefit patients with hemorrhagic cardiovascular and cerebrovascular diseases. Background technique [0002] The 2018 "China Cardiovascular Report" shows that with the acceleration of my country's aging and urbanization, cardiovascular disease has become an important public health problem and the leading cause of death in my country. Aspirin is a kind of cost-effective antiplatelet drug, which is the cornerstone of secondary prevention and treatment of ischemic cardiovascular and cerebrovascular diseases and peripheral vascular diseases. Aspirin irreversibly acetylates the serine residue at position 530 of platelet cyclooxygenase-1 (COX-1), leading to i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6883C12N15/11
CPCC12Q1/6883C12Q2600/156C12Q2600/118C12Q2600/16
Inventor 李晓利王强王宇哲胡晓湘范利曹剑肖漓贾国栋尹慧君
Owner SECOND MEDICAL CENT OF CHINESE PLA GENERAL HOSPITAL
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More