Detection of substances in aspirin's snp sites with protective effect on cardiovascular and cerebrovascular diseases and its application
A technology for cardiovascular and cerebrovascular diseases, aspirin, applied in the direction of recombinant DNA technology, biochemical equipment and methods, microbial measurement/testing, etc., can solve problems such as AR genetics diagnosis and monitoring that are not suitable for Chinese populations, and achieve accurate Prevention and health management throughout the whole process, and the effect of reducing the probability of occurrence
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1 The primers and kits of the present invention used to detect the SNP site rs10306190 (966C>G) of the 3'-UTR of the COX-1 gene
[0030] (1) Name and structure of DNA sequence: COX-1 gene, also known as prostaglandin synthase-1 gene
[0031](prostaglandin synthetase1, PTGS1), Gene ID 5742. Located at 9q32-q33.3, chr9:122,371,024-122,395,703, the upstream 5'-untranslated region (UTR) totals 1862 bp; the downstream untranscribed 3'-UTR totals 3157 bp, the full length is 24,680 bp, consisting of 11 Consists of 10 exons and 10 introns, the COX-1 gene promoter region lacks TATA box, rich in GC region, and performs housekeeping gene function in vivo. 其中rs10306190(966C>G)位点位于3'-UTR ,rs1030619序列信息如SEQ ID No.1所示:SEQ IDNo.1:gactttctgctgggatccttgggcccatcactgtatagacatgctaccactggtacttcctttctccctgcgggccaggcactgcccttttcaggaakct[c / g]tcttaaaatacccattgccccagacctggaagatataacattcagttcccaccatctgattaaaacarcttcctcccttacagagcatacaacagagggg。
[0032] (2) Design multiple PCR primers for...
Embodiment 2
[0042] Example 2 The method for detecting the rs10306190 genotype of COX-1 gene using the primer set and the kit of the present invention
[0043] (1) DNA extraction:
[0044] DNA samples are derived from human leukocytes. 2ml of peripheral venous blood was collected from the patient and placed in an anticoagulation tube. Using the whole genome DNA extraction kit (product of Beijing Tiangen Biochemical Co., Ltd.), according to the instructions, leukocyte genomic DNA was extracted from 1ml peripheral blood, and dissolved in 0.1×TE buffer (10mmol / L Tris-1mmol / LEDTA, pH8.0 ) and stored in a -20°C refrigerator for later use.
[0045] (2) COX-1 genotyping using Fluidigm's nanoscale microfluidics technology:
[0046] In this study, we used the BioMark HD microfluidic chip gene analysis system in our laboratory and purchased a Fluidigm 96×96 genotyping chip (Dynamic Array Chip for Genotyping) to type candidate marker loci. The experimental process is as follows: pre-amplify the s...
Embodiment 3
[0067] Example 3 Association analysis of rs10306190 of COX-1 gene and long-term cardiovascular events in patients taking aspirin
[0068] (1) The best implementation crowd of the present invention:
[0069] Chinese Han population who regularly take the antiplatelet drug aspirin 75mg-100mg / d for secondary prevention in patients with ischemic cardiovascular and cerebrovascular diseases.
[0070] (2) General information of the patients of the embodiment:
[0071] The included cases involved in the present invention were from April 2008 to July 2010, from the military cadre rest center in Beijing, and took the antiplatelet drug aspirin 75mg-100mg / d regularly and throughout the course of the secondary prevention of ischemic cardiovascular and cerebrovascular disease patients 486 There were 334 males (68.7%) and 152 females (31.3%). The average age was 73.86±8.15 (48-92) years old. The remaining features are shown in Table 6.
[0072] (4) Method
[0073] ① Design of multiplex P...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


