Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of reagent for knocking down or inhibiting EGR3 in preparation of medicine for myocardial ischemia-reperfusion injury

A technology for reperfusion injury and myocardial ischemia, applied in the field of biomedicine, can solve the problem that EGR3 protein has not had any related research and reports.

Active Publication Date: 2022-06-07
SHANGHAI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are no related studies and reports on the role and mechanism of EGR3 protein in myocardial ischemia-reperfusion injury

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of reagent for knocking down or inhibiting EGR3 in preparation of medicine for myocardial ischemia-reperfusion injury
  • Application of reagent for knocking down or inhibiting EGR3 in preparation of medicine for myocardial ischemia-reperfusion injury
  • Application of reagent for knocking down or inhibiting EGR3 in preparation of medicine for myocardial ischemia-reperfusion injury

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] 1. Construction of AAV9-shEGR3 adeno-associated virus vector

[0039] The interference vector pHBAAV-U6-MCS-CMV-EGFP ( figure 1 ) and shRNA fragment (positive chain nucleotide sequence shown in SEQ ID NO.1: 5'-AATTCGCCGGAA CTCTCTTATTCGAGCTCTTCTCGAGAAGAGCTCGAATAAGAGAGTTCCGGT TTTTTG-3'; reverse chain nucleotide sequence shown in SEQ ID NO.2: 5'-GATCCAAAAAACCGGAA CTCTCTTATTCGAGCTCTTCTCGAGAAGAGCTCGAATAAGAGAGTTCCGGC G -3') connection, followed by Escherichia coli transformation, after transformation, use conditioned medium (LB medium without resistance) to screen the target strain and then send it to Qingke Company for sequencing, and use nucleic acid extraction kit to extract plasmids to obtain recombination Adenovirus AAV9-shEGR3, sequencing results such as figure 2 shown. according to figure 2 It can be seen from the sequencing structure that the sequencing results are consistent with the target sequence, indicating that the recombinant adenovirus AAV9-shEGR3 was suc...

Embodiment 2

[0043] 1. Mice Grouping and Model Establishment

[0044] Forty experimental mice purchased from Beijing Weitong Lihua Laboratory Animal Technology Co., Ltd. were equally divided into myocardial ischemia-reperfusion injury (IRI) group (experimental group) and sham operation (Sham) group (control group);

[0045] Experimental group: mice were anesthetized by intraperitoneal injection of 4% chloral hydrate at a dose of 10 μL / g. When pressure was applied to the tail end and limbs of the mouse with forceps, the mouse did not respond, and the mouse was considered to be fully anesthetized. The fully anesthetized mice were placed on a constant temperature pad at a temperature of 37°C, and their necks and chests were depilated, and the mouse necks were exposed and disinfected with 75% alcohol. Under the microscope, separate the neck skin, muscle and tissue covering the trachea along a straight line. When the trachea is exposed, a small hole is cut between the two tracheal cartilage ri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for knocking down or inhibiting EGR3 in preparation of a medicine for myocardial ischemia-reperfusion injury. By knocking down EGR3, EGR3 protein expression can be inhibited, the cardiac function after myocardial ischemia reperfusion is improved, cardiac fibrosis after myocardial ischemia reperfusion is reduced, and myocardial hypertrophy after myocardial ischemia reperfusion is improved.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and particularly relates to the application of a reagent for knocking down or inhibiting EGR3 in the preparation of a drug for myocardial ischemia-reperfusion injury. Background technique [0002] Myocardial ischemia-reperfusion injury refers to a pathological process in which the ischemic myocardium can be restored to normal perfusion after partial or complete acute occlusion of coronary arteries and recanalization is obtained within a certain period of time. A series of damaging changes in myocardial ultrastructure, energy metabolism, cardiac function and electrophysiology caused by ischemia are more prominent after recanalization of blood vessels, and even severe arrhythmia may occur and lead to sudden death. Myocardial ischemia-reperfusion injury can occur after open-heart surgery, coronary artery bypass grafting, coronary angioplasty, thrombolysis, and sudden increase in blood volume in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K45/00A61K31/7105A61K31/713A61P9/10A61P9/04
CPCA61K45/00A61K31/7105A61K31/713A61P9/10A61P9/04Y02A50/30
Inventor 肖俊杰周秋莲张潇孟丹妮
Owner SHANGHAI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com