Check patentability & draft patents in minutes with Patsnap Eureka AI!

Construction method and application of severe type A hemophilia animal model

A construction method and animal model technology, applied in the field of gene editing, can solve the problems of long cycle and high cost, reduce workload, reduce off-target rate, and achieve the effect of stability and heritability

Pending Publication Date: 2022-06-07
吴文书
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] The traditional strategy for gene knockout mouse construction is through homologous recombination, such as replacing the target gene with the Neo gene or deleting key exons in the target gene, so as to achieve the knockout of the target gene. high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of severe type A hemophilia animal model
  • Construction method and application of severe type A hemophilia animal model
  • Construction method and application of severe type A hemophilia animal model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] This embodiment provides a gRNA combination targeting FVIII gene, and the gRNA combination targeting FVIII gene includes gRNA3 and gRNA4;

[0080] The gRNA3 includes the nucleotide sequence shown in SEQ ID No.1, and the gRNA4 includes the nucleotide sequence shown in SEQ ID No.2.

[0081] SEQ ID No. 1: CAGTCCGTCACTTAGTTTTATGG;

[0082] SEQ ID No. 2: GTGGTGCCTAATCGTTACTCAGG.

Embodiment 2

[0084] This example provides an FVIII gene editing system, the FVIII gene editing system includes the gRNA combination targeting the FVIII gene in Example 1 and the mRNA of Cas9 nuclease.

[0085] In the present invention, the FVIII gene editing system is prepared by the following method:

[0086] A plasmid containing the sequences encoding gRNA3 and gRNA4 targeting the FVIII gene was constructed, and the fusion gene of T7 promoter and gRNA coding sequence was first amplified by overlapping PCR technology, and cloned into a universal vector (for specific steps, please refer to Cell, 2013, 153:910~ 918), and it was transcribed into RNA in vitro after the sequencing verification was correct;

[0087] The mRNA of Cas9 nuclease is transcribed in vitro and mixed with the obtained gRNA3 and gRNA4 to obtain the FVIII gene editing system.

Embodiment 3

[0089] The present embodiment provides a severe hemophilia A animal model, and the severe hemophilia A animal model is constructed by the following methods:

[0090] (1) Stimulate ovulation in mice (from C57BL / 6 strain), and culture fertilized eggs after in vitro fertilization;

[0091] (2) Microinjecting the FVIII gene editing system in Example 2 into the nucleus of a mouse fertilized egg cell to obtain a recombinant cell;

[0092] (3) The recombinant cells are cultured in vitro and transferred to the surrogate mother mouse;

[0093](4) Extract the DNA from the tail tissue of the mouse, identify it by PCR amplification and sequencing, and select the mouse with the deletion of the FVIII gene as the F0 generation;

[0094] (5) mating the obtained F0 generation mice with wild-type mice to obtain F1 generation heterozygous mice;

[0095] (6) Self-breeding the F1 generation heterozygous mice, using PCR amplification and sequencing to identify, and selecting F2 generation FVIII g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a construction method and application of a severe hemophilia A animal model. A gRNA combination of a targeted FVIII gene comprises gRNA3 and gRNA4; the gRNA3 comprises a nucleotide sequence as shown in SEQ ID No. 1, and the gRNA4 comprises a nucleotide sequence as shown in SEQ ID No. 2. The invention also provides an FVIII gene editing system, a recombinant cell and a construction method thereof, and a construction method of a severe type A hemophilia animal model. Through gene editing and screening, the A-type hemophilia mouse model with the sequence with the length of 10796bp between the exon 23 and the exon 25 of the deleted FVIII gene is successfully constructed, and the A-type hemophilia mouse model can be applied to related researches and has a wide application prospect.

Description

technical field [0001] The invention belongs to the technical field of gene editing, and in particular relates to a construction method of an animal model of severe hemophilia A and its application. Background technique [0002] FVIII (Coagulation Factor VIII) is also known as the eighth coagulation factor, or antihemophilic globulin. FVIII is synthesized in the liver and participates in the blood coagulation reaction, and is an important coagulation factor in the blood. Its deficiency or absence can cause blood coagulation disorders, resulting in continuous bleeding, which is clinically characterized as hemophilia A. Hemophilia A is a genetic coagulation disorder caused by a mutation in the coagulation factor VIII gene. It is an X-sex-linked recessive hereditary disease, which usually affects males and is transmitted in females. Female patients are extremely rare, with an incidence of 1 / 5000 in males, accounting for 80% to 85% of the incidence of hemophilia. [0003] FV...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/55C12N9/22C12N5/10C12N5/073C12N15/89A01K67/027A61K49/00
CPCC12N15/113C12N9/22C12N5/0604C12N15/89A01K67/0276A61K49/0008C12N2310/20C12N2510/00A01K2217/075A01K2217/15A01K2227/105A01K2267/0306
Inventor 吴文书
Owner 吴文书
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com