Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for efficiently expressing active Dog Growth Hormone (GH) growth hormone

A high-efficiency expression technology of growth hormone, applied in the field of high-efficiency expression of active DogGrowthHormone growth hormone, can solve the problems of slow growth, poor effect, high cost, etc., achieve the effect of three-dimensional protein structure, increase translation efficiency, and improve yield

Inactive Publication Date: 2022-07-05
武汉天正源生物科技有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The invention provides a method for efficiently expressing active Dog Growth Hormone (GH) growth hormone, which solves the problem of slow growth of dogs suffering from dwarfism through injection of growth hormone, but currently the growth hormone injected into dogs is bovine The source of growth hormone has poor effect, and the Escherichia coli expression system has low yield and poor activity, and the growth hormone used in dogs has poor growth stability, low safety and high cost.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for efficiently expressing active Dog Growth Hormone (GH) growth hormone
  • Method for efficiently expressing active Dog Growth Hormone (GH) growth hormone
  • Method for efficiently expressing active Dog Growth Hormone (GH) growth hormone

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0027] Below in conjunction with embodiment, the present invention is described in further detail:

[0028] like Figure 1-6 As shown, the present invention provides a method for highly expressing active Dog Growth Hormone (GH) growth hormone, which consists of the following steps:

[0029] Step 1. Synthesis of the target gene, look up the Dog Growth Hormone gene sequence on the NCBI website, the specific website is https: / / www.ncbi.nlm.nih.gov / nuccore / NM_008117.3), take the Dog cDNA library as a template, use The designed upstream and downstream primers were amplified by PCR to obtain the Growth Hormone (GH) target gene fragment. The Growth Hormone (GH) gene itself has a signal peptide, and the primers were designed without the signal peptide sequence. The gene sequence is:

[0030] Ttt ccc gcc atg ccc ttgtccagtc tgttttctaa tgctgtgctc cgagcccagcacctgcacca gctggctgct gacacctaca aagagttcga gcgtgcctac attcccgagg gacagcgctattccattcag

[0031] aatgcccagg ctgctttctg cttctcagag acca...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for high-efficiency expression of active Dog Growth Hormone (GH) growth hormone, and relates to the technical field of gene recombination, and the method comprises the following steps: step 1, synthesis of a target gene, step 2, sequencing of the target gene, step 3, connection of a Growth Hormone (GH) gene and an expression vector, step 4, transformation of a recombinant plasmid PTZY1-GH, step 5, enzyme digestion identification of the recombinant plasmid, and step 6, purification of the recombinant plasmid. The method comprises the following steps of: 1, extracting an endotoxin-free plasmid, 7, transfecting CHOS (hamster ovary) cells, 8, purifying target protein, and 9, verifying whether the expressed target protein has disulfide bonds or not and verifying the proliferation activity of the cells. The expressed protein is stable in quality and high in yield which can reach 1-2 g / L, the product is uniform, a domestic culture medium is adopted for cell culture, compared with an imported culture medium, the raw material cost can be greatly saved, large-scale production is easy, and meanwhile, the recombinant Dog Gh recombinant protein has Nb2-11 cell proliferation activity and can be used for follow-up development of dog growth hormone drugs.

Description

technical field [0001] The invention relates to the technical field of gene recombination, in particular to a method for efficiently expressing active Dog Growth Hormone (GH) growth hormone. Background technique [0002] Recombinant protein technology uses the method of genetic engineering to connect the target protein DNA obtained in vitro to an expression vector, and the constructed expression vector is transfected into the target cell, and the target protein is obtained by in vitro culture. Production is mainly divided into two categories: eukaryotic expression system and prokaryotic expression system: the prokaryotic expression system mainly uses Escherichia coli E Coli as an expression strain, which has the advantages of low cost, high efficiency, and low environmental requirements. The disadvantage is that the expression Proteins often exist in the form of inclusion bodies, which cannot fold normally and present a correct three-dimensional structure, resulting in the i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/61C07K1/22C12N15/18C12N15/85C12N15/66
CPCC07K14/61C12N15/85C12N15/66C12N2800/107
Inventor 王元涛
Owner 武汉天正源生物科技有限公司