Method for efficiently expressing active Dog Growth Hormone (GH) growth hormone
A high-efficiency expression technology of growth hormone, applied in the field of high-efficiency expression of active DogGrowthHormone growth hormone, can solve the problems of slow growth, poor effect, high cost, etc., achieve the effect of three-dimensional protein structure, increase translation efficiency, and improve yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0027] Below in conjunction with embodiment, the present invention is described in further detail:
[0028] like Figure 1-6 As shown, the present invention provides a method for highly expressing active Dog Growth Hormone (GH) growth hormone, which consists of the following steps:
[0029] Step 1. Synthesis of the target gene, look up the Dog Growth Hormone gene sequence on the NCBI website, the specific website is https: / / www.ncbi.nlm.nih.gov / nuccore / NM_008117.3), take the Dog cDNA library as a template, use The designed upstream and downstream primers were amplified by PCR to obtain the Growth Hormone (GH) target gene fragment. The Growth Hormone (GH) gene itself has a signal peptide, and the primers were designed without the signal peptide sequence. The gene sequence is:
[0030] Ttt ccc gcc atg ccc ttgtccagtc tgttttctaa tgctgtgctc cgagcccagcacctgcacca gctggctgct gacacctaca aagagttcga gcgtgcctac attcccgagg gacagcgctattccattcag
[0031] aatgcccagg ctgctttctg cttctcagag acca...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


