Application of gene regulator in preparation of liver cancer metastasis medicine
A regulator and gene technology, applied in the field of biology, can solve the problems of inability to encode proteins, no significant improvement in the 5-year survival rate of liver cancer patients, lack of open reading frames, etc., and achieve the effect of inhibiting invasion
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] (1) Collect the venous blood of 50 patients with liver cancer and 50 normal people;
[0029] (2) Take 2ml of venous blood, adjust the centrifuge speed to 3500 rpm, and centrifuge for 10 minutes. At this time, the blood is divided into two layers, the upper layer is pale yellow plasma, and the lower layer is cells;
[0030] (3) Remove the plasma in the upper layer, add normal saline in a ratio of 1:1 and mix gently;
[0031] (4) Add 4 ml of lymphocyte separation solution to an enzyme-free centrifuge tube, carefully pour the cells mixed with normal saline into the centrifuge tube, adjust the centrifuge speed to 1500 rpm, and centrifuge for 20 minutes;
[0032] (5) At this time, the liquid is divided into 3 layers, the top layer is pale yellow plasma, the middle layer is milky white lymphocytes, and the lower layer is red blood cells, carefully suck the cells in the middle layer into the centrifuge tube, Adjust the speed of the centrifuge to 10,000 rpm, and centrifuge for...
Embodiment 2
[0035] (1) Add 1ml Trizol to the obtained mononuclear cells, and use a pipette to pipette the cells;
[0036] (2) Add 200ul of chloroform, mix well and place at room temperature for 5 minutes, then place in a centrifuge for centrifugation;
[0037] (3) After the centrifugation, carefully suck the upper water phase into a new non-enzyme centrifuge tube, add isopropyl alcohol, place it on ice for 10 minutes, and then place it in a centrifuge for centrifugation. After the centrifugation, keep the precipitate;
[0038] (4) Add 500ul of pre-cooled 70% ethanol to dissolve the precipitate, after centrifugation, discard the supernatant, dry at room temperature for 5-10 min, and add DEPC water to obtain RNA;
[0039] Composition Usage amount 5×gDNA Buffer 2μL TotaL RNA 2μg RNase-Free ddH 2 O
Make up to 10 μL
[0040] The set reaction conditions were: 42 °C, 3 min, and placed on ice after the end.
[0041] Composition Usage amount ...
Embodiment 3
[0054] The present invention provides a fluorescent quantitative PCR kit for diagnosing liver cancer, which includes SYBR⑩PremixEx Taq II, ENST00000415932.1 gene upstream primer, ENST00000415932.1 gene downstream primer, ROXReference Dye, DNA model and dH 2 O;
[0055] The upstream primer sequence of ENST00000415932.1 gene is as follows: CTGGACGACACAGTGAGACC, SEQ ID NO.2;
[0056] The downstream primer sequence of ENST00000415932.1 gene is as follows: GGCTCAATGGTTCATGCCTG, SEQ ID NO.3.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


