Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of gene regulator in preparation of liver cancer metastasis medicine

A regulator and gene technology, applied in the field of biology, can solve the problems of inability to encode proteins, no significant improvement in the 5-year survival rate of liver cancer patients, lack of open reading frames, etc., and achieve the effect of inhibiting invasion

Active Publication Date: 2022-07-08
SHANDONG NORMAL UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the treatment technology of liver cancer has been continuously improved, the 5-year survival rate of liver cancer patients has not improved significantly
[0003] LncRNA is a transcript with a length greater than 200nt, which cannot encode proteins due to the lack of an open reading frame

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gene regulator in preparation of liver cancer metastasis medicine
  • Application of gene regulator in preparation of liver cancer metastasis medicine
  • Application of gene regulator in preparation of liver cancer metastasis medicine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] (1) Collect the venous blood of 50 patients with liver cancer and 50 normal people;

[0029] (2) Take 2ml of venous blood, adjust the centrifuge speed to 3500 rpm, and centrifuge for 10 minutes. At this time, the blood is divided into two layers, the upper layer is pale yellow plasma, and the lower layer is cells;

[0030] (3) Remove the plasma in the upper layer, add normal saline in a ratio of 1:1 and mix gently;

[0031] (4) Add 4 ml of lymphocyte separation solution to an enzyme-free centrifuge tube, carefully pour the cells mixed with normal saline into the centrifuge tube, adjust the centrifuge speed to 1500 rpm, and centrifuge for 20 minutes;

[0032] (5) At this time, the liquid is divided into 3 layers, the top layer is pale yellow plasma, the middle layer is milky white lymphocytes, and the lower layer is red blood cells, carefully suck the cells in the middle layer into the centrifuge tube, Adjust the speed of the centrifuge to 10,000 rpm, and centrifuge for...

Embodiment 2

[0035] (1) Add 1ml Trizol to the obtained mononuclear cells, and use a pipette to pipette the cells;

[0036] (2) Add 200ul of chloroform, mix well and place at room temperature for 5 minutes, then place in a centrifuge for centrifugation;

[0037] (3) After the centrifugation, carefully suck the upper water phase into a new non-enzyme centrifuge tube, add isopropyl alcohol, place it on ice for 10 minutes, and then place it in a centrifuge for centrifugation. After the centrifugation, keep the precipitate;

[0038] (4) Add 500ul of pre-cooled 70% ethanol to dissolve the precipitate, after centrifugation, discard the supernatant, dry at room temperature for 5-10 min, and add DEPC water to obtain RNA;

[0039] Composition Usage amount 5×gDNA Buffer 2μL TotaL RNA 2μg RNase-Free ddH 2 O

Make up to 10 μL

[0040] The set reaction conditions were: 42 °C, 3 min, and placed on ice after the end.

[0041] Composition Usage amount ...

Embodiment 3

[0054] The present invention provides a fluorescent quantitative PCR kit for diagnosing liver cancer, which includes SYBR⑩PremixEx Taq II, ENST00000415932.1 gene upstream primer, ENST00000415932.1 gene downstream primer, ROXReference Dye, DNA model and dH 2 O;

[0055] The upstream primer sequence of ENST00000415932.1 gene is as follows: CTGGACGACACAGTGAGACC, SEQ ID NO.2;

[0056] The downstream primer sequence of ENST00000415932.1 gene is as follows: GGCTCAATGGTTCATGCCTG, SEQ ID NO.3.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of a gene regulator in preparation of a liver cancer metastasis medicine, and belongs to the technical field of biology. The biomarker provided by the invention is an ENST00000415932.1 gene, and experiments find that the ENST00000415932.1 gene is in low expression in peripheral blood mononuclear cells of a liver cancer patient, and the ENST00000415932.1 gene has a relatively high diagnostic value when being used for diagnosis. Moreover, the invention finds that invasion of liver cancer cells can be effectively inhibited by overexpressing the ENST00000415932.1 gene in the liver cancer cells, so that the plasmid for promoting overexpression of the ENST00000415932.1 gene can be used for preparing the medicine for treating liver cancer metastasis.

Description

technical field [0001] The invention belongs to the technical field of biology, and particularly relates to the application of a gene regulator in the preparation of a liver cancer metastasis drug. Background technique [0002] Liver cancer is one of the most common malignant tumors worldwide. Hepatocellular carcinoma has a high degree of heterogeneity, so it has the characteristics of easy metastasis, recurrence and drug resistance compared with other solid tumors. Although the treatment technology of liver cancer has been continuously improved, the 5-year survival rate of liver cancer patients has not been significantly improved. [0003] LncRNA is a transcription product with a length of more than 200 nt, which cannot encode proteins due to its lack of open reading frames. When first discovered, lncRNAs were considered junk genes with no biological function. However, subsequent studies have shown that lncRNAs can participate in the physiological activities of cells thr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12Q1/686C12N15/11
CPCC12Q1/6886C12Q1/686C12Q2600/158C12Q2563/107C12Q2545/114Y02A50/30
Inventor 苏维娜
Owner SHANDONG NORMAL UNIV