Molecular marker capable of distinguishing Brucella abortus from Brucella melitensis and detection method

A technology of Brucella sheep and Brucella canis, applied in the field of pathogen molecular detection, can solve the problems of staff infection, limited promotion and application, time-consuming and laborious, etc.

Pending Publication Date: 2022-07-26
CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Because of the need for bacterial culture, the staff have the risk of infection, so the isolation and identification of pathogens must be carried out in a biosafety level 3 laboratory, which limits the popularization and application of this method
On the other hand, it takes at least two weeks for bacterial culture and identification, which is time-consuming and laborious, and cannot meet the current requirements for fast and efficient outbreak handling

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker capable of distinguishing Brucella abortus from Brucella melitensis and detection method
  • Molecular marker capable of distinguishing Brucella abortus from Brucella melitensis and detection method
  • Molecular marker capable of distinguishing Brucella abortus from Brucella melitensis and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Selection of Brucella-specific nucleic acid fragments and design of primers and probes

[0044] The Brucella 31kDa immunogenic protein gene Bcsp31 is a Brucella-specific gene that exists in all species of Brucella genomes and is highly conserved. The gene is located on Brucella chromosome I (817,132-818,121), with a total of 990 bases. Using AlleleID 6 software, a set of specific primers and Taqman probes for the above sequences were obtained, and the sequences amplified by the primers were:

[0045]CCGGAGCCTATAAGGACGTGGCGGAAACACCGACCCTTGCCGTTGCCGCACAGTGGGTGACGAGGCGCAAGCAGCCGGACGACCTCATCTATAACATCACCAAGGTTCTCTGGAACGAGGATACACGCAA (SEQ ID NO: 1)

[0046] Upstream primer: 5'-CCGGAGCCTATAAGGACGTG-3' (SEQ ID NO: 2);

[0047] Downstream primer: 5'-TTGCGTGTATCCTCGTTCCAG-3' (SEQ ID NO: 3);

[0048] Probe sequence: 5'-ACCGACCCTTGCCGTTGCCGC-3' (SEQ ID NO: 4);

[0049] According to the performance of real-time fluorescence quantitative PCR instrument, the fluorescent...

Embodiment 2

[0051] Embodiment 2: the selection of specific nucleic acid fragment of bovine species Brucella and the design of primer and probe

[0052] Since there are currently only reports of cattle, sheep, pig and canis Brucella in my country, according to the NCBI genome database (https: / / www.ncbi.nlm.nih.gov / genome) the cattle, sheep and The genome sequences of Brucella species, canine species and swine species were analyzed and compared, and a site that was highly conserved in the genome of Brucella bovis and missing in other species of Brucella was screened out. This site is located on chromosome II of Brucella bovis (B. abortus 2308 strain is an example: 157624-157704), and the sequence of its nucleotide fragment is as follows:

[0053] CAGTTCTCGAACAAGCTGACGGGCAGCGGCACGCTTGCTGTGTCGGGTTCTGGCACGCTGATCCTTTCGGCGGCCAATGATTATAG (SEQ ID NO: 5). The detection results show that the sequence exists in all Brucella bovis genomes, and the sequence homology with other species of Brucella is ve...

Embodiment 3

[0060] The selection of embodiment 3 Brucella sheep species specific nucleic acid fragment and primer, probe design

[0061] Similarly, through the sequence comparison analysis of the bovine, sheep, canine and suis Brucella genomes in the NCBI Brucella genome database, we screened out one that is highly conserved in the genome of Brucella sheep and is highly conserved in other species. deleted loci in the Brucella genome. This locus is located on chromosome 1 of Brucella melitensis (B.melitensis 16M strain is an example: 1209463-1209635), and the sequence of its nucleotide fragment is as follows:

[0062] AGCGAGATTGGAATAGCTTACCCGCCAATCTTCGCCCTGCCACCAGCCAATAACGGCAATTATCGCTGTCACTGTTGCAAGTATGGCAGCGAGCGCTCTAGCGTGACGAAGCACTGTCTTTCTGACAATTTCCAGATTCACCCCTAGGGCGTGTCTGCATTCAACGTAACCAG (SEQ ID NO: 9). This sequence is imported into the NCBI website and retrieved with the Blast function, and this sequence all exists in all Brucella sheep genomes, and the genome sequence homology with ot...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a molecular marker capable of distinguishing Brucella abortus and Brucella melitensis and a detection method. The sequence of a specific nucleotide fragment capable of identifying all Brucella is SEQ ID NO: 1; the nucleotide sequence of the specific molecular marker for detecting Brucella abortus is SEQ ID NO: 5; the nucleotide sequence of the specific molecular marker for detecting Brucella melitensis is SEQ ID NO: 9. The invention also provides a primer pair and a probe for detecting the specific accounting fragment. The BSCP primer and the probe prepared by the invention have universality and can detect all Brucella, and the primer and the probe not only can be independently used, but also can be prepared into a triple real-time fluorescent quantitative PCR method for identifying the Brucella. The detected samples can be separated strains and can also be clinically collected abortion substances, milk, swabs, tissues and other samples, and the kit has the characteristics of high sensitivity, high specificity and the like.

Description

technical field [0001] The invention belongs to the technical field of pathogen molecular detection, in particular to a molecular marker capable of distinguishing between bovine species and ovine species Brucella, and a real-time fluorescence quantitative PCR primer, probe and detection method for detecting the molecular marker. Background technique [0002] Brucellosis (hereinafter referred to as brucellosis) is an important zoonotic infectious disease caused by Brucella, and it is an animal disease that must be notified by the International Organization for Animal Health (OIE). The Republic Act on the Prevention and Control of Infectious Diseases stipulates that it is a Class B infectious disease. The disease not only harms cattle, sheep, pigs and other animals, causing serious economic losses, but also transmits the disease to humans through diseased animals or animal products, causing fever, orchitis, miscarriage, and arthritis in humans. Even the loss of labor and ferti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/689C12Q1/686C12N15/11C12R1/01
CPCC12Q1/689C12Q1/686C12Q2600/16C12Q2600/156C12Q2537/143C12Q2563/107
Inventor孙明军焉鑫刘蒙达田莉莉孙世雄魏润宇邵卫星孙淑芳孙翔翔樊晓旭张浩博
OwnerCHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT